Search PubMed⌕ Search

Biomedical subjects

K Tamura

Publications and source records attributed to K Tamura.

At least 505 records · Page 28Linked to original sources
PubMed1997

[A case of mitochondrial cardiomyopathy with heart failure, sick sinus syndrome and diabetes mellitus: mitochondrial DNA adenine-to-guanine transition at 3243 of mitochondrial tRNA(LEU)(UUR) gene].

A 42-year-old woman with diabetes mellitus lost consciousness and was transferred to the Yokohama City University Hospital. Blood chemistry findings indicated low blood sugar levels and chest X-ray examination revealed cardiomegaly and bilateral pleural effusions. These clinical abnormalities were corrected by treatment with glucose, diuretics, angiotensin converting enzyme inhibitor and digitalis. Cardiological laboratory examinations were performed after admission. Electrocardiography revealed first degree atrioventricular block and incomplete right bundle branch block. Ultrasonography showed lower grade of ejection fraction and diffuse hypokinesis of the cardiac wall. After admission, sinus arrest suddenly occurred. The diagnosis was sick sinus syndrome. Scintigraphy using iodine-123 betamethyl-p-iodophenyl-pentadecanoic acid showed abnormal mottled defects. Coronary angiography found no significant stenosis of the coronary artery. Electron microscopy showed abnormally shaped mitochondrial accumulations in an endomyocardial biopsy specimen. Mitochondrial DNA amplification by polymerase chain reaction followed by restriction enzyme Apa I digestion revealed adenine-to-guanine transition at 3243 of the mitochondrial tRNA(LEU)(UUR) gene.

Adult↗
PubMed1997

Regulation of cardiac angiotensinogen mRNA in vivo and in vitro.

In this study, to investigate the mechanism of hypertension-associated induction of cardiac angiotensinogen in vivo and in vitro, we studied the regulation of angiotensinogen mRNA in the hearts of genetically hypertensive rats and in the rat cardiomyocytes. Levels of cardiac angiotensinogen mRNA were significantly increased in the hypertensive rats. Steady state mRNA levels for angiotensinogen mRNA in cardiomyocytes were increased by angiotensin II and mechanical stretch. The addition of an angiotensin II type 1 receptor antagonist (CV11974) and a transcriptional inhibitor (actinomycin D) completely blocked the induction of angiotensinogen mRNA by angiotensin II in cardiomyocytes. The addition of CV11974 significantly, but not completely, inhibited the induction of angiotensinogen mRNA by mechanical stretch. Actinomycin D completely blocked the induction of angiotensinogen mRNA by stretch in cardiomyocytes. An angiotensin II type 2 receptor antagonist (PD123319) and a protein synthesis inhibitor (cycloheximide) did not affect the induction. These results indicate that the expression of cardiac angiotensinogen mRNA is activated by the development of hypertensive cardiac hypertrophy, and that angiotensin II and mechanical stretch activates the angiotensinogen gene via the angiotensin II type 1 receptor-pathway in cardiomyocytes.

Angiotensinogen↗
PubMed1997

Recognition of tRNA(Gly) by three widely diverged glycyl-tRNA synthetases: evolution of tRNA recognition.

Glycyl-tRNA synthetase (GlyRS) is an unusual aminoacyl-tRNA synthetase because it varies in its quarternary structure between organisms; Escherichia coli GlyRS is an alpha 2 beta 2 tetramer, whereas those of Thermus thermophilus and yeast are alpha 2 dimers. In contrast, the tRNA(Gly) sequence is virtually identical in E. coli and T. thermophilus but very different in yeast. In this study, we examined the molecular recognition of tRNA(Gly) by three widely diverged GlyRSs using in vitro tRNA transcripts. The results obtained in the mutation studies indicate that despite such large differences of the two prokaryotic GlyRSs, tRNA(Gly) identity has been essentially conserved in prokaryotes, and that there are also differences in the acceptor stem recognition between prokaryotes and yeast. The clear separation between prokaryotes and yeast is retained in the identity element location, whereas the apparent diversity of the two prokaryotic enzymes does not reflect on the tRNA recognition.

Base Sequence↗
PubMed1997

Role of the CCA end of tRNA and its vicinity in aminoacylation.

The CCA sequence is common to all the 3' ends of tRNAs and more than half of the tRNAs possess the G1C72 base pair at the end of acceptor stem. To study the role of these terminal trinucleotides and their vicinity in the aminoacylation process, not only the substitutions of these bases but also the nucleotide-additions at the 5' end of tRNA were introduced into many kinds of Escherichia coli tRNA transcripts and the effects on the aminoacylation activity with cognate aminoacyl-tRNA synthetase were investigated. Basically the requirement of the CCA sequence in aminoacylation differed among each amino acid specific tRNA. Some rough conclusions could be drawn from the present results. It was found that the G1C72 base pair functioned as the negative identity elements in many tRNAs. The nucleotide-addition experiments suggested that proper spatial arrangement and flexibility were important for aminoacylation reaction. Functional and evolutional implications of the invariant CCA sequence and its vicinity were discussed.

Base Sequence↗
PubMed1996

Activation of circulating platelets by hyperthermal stress.

To determine the involvement of activated platelets in the frequent thrombosis after hot hot-spring bathing, we examined effects of a hyperthermal stress on platelets in vivo. Plasma levels of beta-thromboglobulin (beta-TG) began to rise at 5 minutes and elevated significantly 10 minutes after the start of traditional 47 degrees C hot-spring bathing. In contrast, there was no significant factor 4 change in plasma beta-TG level through a control 10-minute bath in the same water at 42 degrees C. A beta-TG to platelet factor 4 ratio, a value suggested to be useful for evaluating clinical studies for in vitro versus in vivo granule release, was sufficiently high in each sampling, indicating that the experiment was performed without being influenced by artificial platelet activation. These data show that only a few minutes' hyperthermal stress can induce granule release from platelets in vivo.

Adult↗
PubMed1996

Structure and chromosomal assignment of the human cyclin G gene.

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.

Amino Acid Sequence↗
PubMed1996

Functional conservation of mouse Notch receptor family members.

All the known members of the mouse Notch receptor family were examined for their biochemical function by interaction with a DNA binding protein RBP-Jkappa. mNotch2, mNotch3 and int3 (= mNotch4) were shown to interact with RBP-Jkappa by the GST-fusion pull down assay and dominant negative competition with Epstein Barr virus nuclear antigen 2. Furthermore the intracellular region of int3 was shown to transactivate the Epstein Barr virus TP1 promoter. These results indicate that all mouse Notch family members have biochemical functions similar to mNotch1, which transduces proliferative signal by direct interaction with the DNA binding protein RBP-Jkappa.

Amino Acid Sequence↗
PubMed1996

Actions of CP-060S on veratridine-induced Ca2+ overload in cardiomyocytes and mechanical activities in vascular strips.

CP-060S, (-)-(S)-2-[3,5-bis(1, 1-dimethylethyl)-4-hydroxyphenyl]-3-[3-[N-methyl-N-[2-(3, 4-methylenedioxyphenoxy)ethyl]amino]propyl]-1,3-thiazolidin- 4-one hydrogen fumarate, is a novel cardioprotective drug which is designed to prevent Ca2+ overload and cause vasorelaxation. The effects of this compound were evaluated and compared with those of CP-060R (enantiomer of CP-060S,) and diltiazem (Ca2+ channel antagonist) in a veratridine-induced model of Ca2+ overload and vasorelaxation. After 5-min superfusion of veratridine (74 microM), intracellular free calcium concentrations ([Ca2+]i) of rat single cardiomyocytes, as measured with the fura-2 procedure, were greatly elevated, from 44 +/- 5 nM to 3705 +/- 942 nM, and subsequently generated cell contracture. Pretreatment of cardiomyocytes with more than 300 nM of CP-060S or CP-060R for 30 min provided almost complete protection against the veratridine-induced cell contracture; in CP-060S(1 microM)-treated myocytes, [Ca2+]i were minimal and partially elevated from 42 +/- 5 nM to 72 +/- 14 nM after 5 min of veratridine superfusion. In comparison, diltiazem showed no protection below 1 microM and only partial protection at 10 microM. CP-060S, CP-060R and diltiazem all shifted the concentration-response curve for CaCl2 to the right in a competitive manner in depolarized rat thoracic aorta. The pA2 values of CP-060S, CP-060R and diltiazem were 9.16 +/- 0.18, 8.24 +/- 0.14 and 7.66 +/- 0.09, respectively. Our results indicate that CP-060 behaves stereoselectively as a Ca2+ channel antagonist and non-stereo-selectively to protect against veratridine-induced contracture. The latter effect suggests that Ca2+ entry blockade is not the mechanism by which CP-060S exerts cardioprotection.

Animals↗
PubMed1996

Annual changes in colorectal carcinoma incidence in Japan. Analysis of survey data on incidence in Aomori Prefecture.

BACKGROUND: In recent years, the mortality rate for colorectal carcinoma in Japan has rapidly been increasing, and there are indications that it may surpass that of gastric carcinoma, with colorectal carcinoma fast becoming one of the main targets of cancer treatment in Japan. METHODS: Eight thousand three hundred and eighty-six case records of colorectal carcinoma (4479 males and 3907 females; 4691 colon carcinoma cases and 3695 rectal carcinoma cases), diagnosed over 18 years from 1974 to 1991 in Aomori Prefecture, were analyzed. RESULTS: Age-adjusted incidence for colorectal carcinoma per 100,000 population were 12.6 and 8.7 for males and females, respectively, in 1974. The corresponding rates were 20 and 13.6, respectively, in 1980, and 42.5 and 25.6, respectively, in 1991. Among patients with colon carcinoma, a higher proportion have sigmoid colon carcinoma. The degree of increase in the incidence of sigmoid colon carcinoma was almost the same as that of right-sided colon carcinoma. By birth cohort analysis, among those born in 1934 or earlier, the incidence at the same age was higher in the younger population. CONCLUSION: It is possible that the age-adjusted incidence of colorectal carcinoma in Japan will soon resemble that of the white population in the United States, in a manner similar to that of Japanese-Americans.

Adult↗
PubMed1996

An intensive chemotherapy of adult T-cell leukemia/lymphoma: CHOP followed by etoposide, vindesine, ranimustine, and mitoxantrone with granulocyte colony-stimulating factor support.

SUMMARY: An intensive combination chemotherapy regimen supported by granulocyte colony-stimulating factor (G-CSF) was evaluated in adult T-cell leukemia/lymphoma (ATLL) patients in a multiinstitutional, cooperative study. Vincristine 1 mg/m2 i.v. day 1, Adriamycin 40 mg/m2 i.v. day 1, cyclophosphamide 400 mg/m2 i.v. day 1, prednisolone 40 mg/m2 i.v. days 1 to 3 and 8 to 10, etoposide 35 mg/m2 i.v. days 1 to 8, vindesine 2 mg/m2 i.v. day 8, ranimustine 50 mg/m2 i.v. day 8, mitoxantrone 7 mg/m2 i.v. day 8, and G-CSF 50 mg/m2 s.c. days 9 to 21 were given for 2 to 4 courses every 3 weeks to 83 patients with ATLL. Complete remission (CR) and partial remission (PR) were achieved in 35.8 and 38.3 percent, respectively, of 81 evaluable patients. The median survival of all patients was 8.5 months, with a predicted 3-year survival of 13.5 percent by the Kaplan-Meier method. The median duration of response was 7.6 months (range 0.2-42.7), and 13 patients were alive. Their median survival time was 29.1 months (range 19.2-44.7). In 67.6 percent of courses, white blood cell (WBC) nadirs were < 1.0 x 10(9)/L. Days required for the recovery of WBC from the nadir to > 1.0 x 10(9)/L were <5 days in 71.4 percent of the treatment courses. The G-CSF supported an intensified chemotherapy regimen for ATLL and yielded better response rate and longer survival compared to previous reports in Japan. Because duration of remission is still short, further studies of postremission therapy or other strategies are warranted.

Adult↗
PubMed1996

Citral, an inhibitor of retinoic acid synthesis, modifies chick limb development.

Exogenously applied retinoic acid (RA) is known to affect cartilage pattern in developing and regenerating limbs. There are, however, few reports which analyze the participation of endogenous RA in limb pattern formation. Using an organ culture system, we attempted to reduce the concentration of endogenous RA in the developing chick wing buds by the treatment with citral (3,7-dimethyl-2,6-octadienal), an inhibitor of retinoic acid formation. After this treatment, the cultured wing buds were grafted to the stumps of host embryos. These citral-treated limb buds frequently formed truncated cartilage elements and the defects were rescued by simultaneous treatment with an appropriate concentration of RA. These results suggest that endogenous RA plays a role in chick limb bud development.

Acyclic Monoterpenes↗
PubMed1996

Sustained ventricular tachycardias associated with myotonic dystrophy.

Patients with myotonic dystrophy are reported to have a higher frequency of sudden death than the general population. Although causes of sudden death in myotonic dystrophy are suggested to be due to conduction of defects progressing, the HV interval cannot predict whether conduction system disease would develop or progress. We report two cases of myotonic dystrophy complicated with sustained monomorphic ventricular tachycardias (VT), which can cause sudden death. In Case No. 1, although the patient was treated successfully for sustained VT with verapamil in electrophysiologic studies, another sustained VT was confirmed 2 years later. In Case No. 2, the patient showed decreased left ventricular ejection fraction and late potentials, and induced sustained VT that was identical to clinically documented VT. Although VT is believed to be rare in patients with myotonic dystrophy, these cases suggest that VT is a possible cause of sudden death.

Adult↗
PubMed1996

Stimulation of interleukin-1beta-converting enzyme activity during growth inhibition by CPT-11 in the human myeloid leukemia cell line K562.

Camptothecin (CPT) was first extracted from Camptotheca acuminata and has a strong antitumor effect. Its water-soluble derivative, CPT-11, has higher therapeutic efficacy and less toxicity than CPT. Recently, CPT-treated cells have been shown to undergo apoptosis. However, the mechanism of induction of apoptosis by CPT has not been characterized in detail in any type of cells. On the other hand, interleukin-1beta-converting enzyme (ICE) is a mammalian homologue of CED3, a protein required for apoptosis in the nematode Caenorhabditis elegans. To determine how CPT-11 brings about cell death by apoptosis, we investigated the effects of CPT-11 on the expression of ICE activity in K562 cells, which represent human myeloid leukemia cells. The proliferation of K562 cells was shown to be inhibited by the presence of CPT-11 in the culture medium. We also found that the levels of mRNA for ICE in the cells were increased in the presence of CPT-11. Furthermore, we demonstrated that when CPT-11 was added to the culture medium, apoptosis of K562 cells was clearly detected in situ. These features suggested that CPT-11 enhances the apoptotic cell death in K562 cells and that a part of induction of apoptosis by CPT-11 may be correlated with the stimulation of the ICE activity.

Apoptosis↗
PubMed1996

Role of endogenous hypergastrinemia in regenerating endocrine pancreas after partial pancreatectomy.

We studied the possible role of endogenous gastrin in the regenerating pancreas. Male Wistar rats underwent sham operation or 90% partial pancreatectomy (Px). Lansoprazole (30 mg/kg body wt), a proton pump inhibitor (PPI), was given p.o. for 3 weeks after surgery. Plasma glucose levels were higher in Px rats than in shams. Lansoprazole lowered plasma glucose levels in the Px rats. In addition, integrated insulin secretion during an oral glucose tolerance test (2 g/kg body wt) was significantly (p < 0.01) higher in lansoprazole-treated Px rats than in control Px rats, while lansoprazole did not affect insulin secretion in shams. Fasting serum gastrin levels were higher (p < 0.01) in lansoprazole-treated animals than in controls both in sham rats and in Px rats. Furthermore, lansoprazole increased the pancreas weight per body weight and elevated the insulin content of the pancreas in Px rats. These results suggest that endogenous hypergastrinemia has a trophic effect on endocrine pancreas during regenerating processes and that administration of PPI may be clinically beneficial to the remnant pancreas after pancreatectomy if the whole stomach is preserved.

2-Pyridinylmethylsulfinylbenzimidazoles↗
PubMed1996

Distribution of nitric oxide synthase-containing nerves in the aganglionic intestine of mutant rats: a histochemical study.

We examined the distribution of nerves containing nitric oxide synthase in the intestine of congenitally aganglionic rats, using a reduced nicotinamide adenine dinucleotide phosphate diaphorase histochemical method for whole-mount and cryostat specimens. A constricted intestinal segment extends from the terminal ileum to the anus in this mutant. No nerve elements with the activity were found in the affected terminal ileum, cecum and proximal colon. Although intrinsic ganglionic neurons were absent along the constricted intestine, nerve fibers with the activity were found in both the submucous and intermuscular layers distal to the proximal colon. These fibers increased in density towards the rectum, forming hypertrophic nerve bundles and unusual fiber networks. However, positive fibers were never seen within the circular and longitudinal musculature of the constricted lesion. Some of these hypertrophic nerve bundles were continuous with ectopic ganglia that were situated in the adventitial connective tissue around the lower rectum and in the submucosa near the anus. The hypertrophic nerve bundles seemed to have an extrinsic origin; some of them may have originated from ectopic ganglia. These results suggest that the defective distribution of nerves containing nitric oxide synthase may be involved in the pathogenesis of congenital colonic aganglionosis.

Animals↗