Biomedical subjects

K Takeo

Publications and source records attributed to K Takeo.

At least 19 recordsLinked to original sources

PubMed2006

The cytoskeleton in the unique cell reproduction by conidiogenesis of the long-neck yeast Fellomyces (Sterigmatomyces) fuzhouensis.

The morphology of conidiogenesis and associated changes in microtubules, actin distribution and ultrastructure were studied in the basidiomycetous yeast Fellomyces fuzhouensis by phase-contrast, fluorescence, and electron microscopy. The interphase cell showed a central nucleus with randomly distributed bundles of microtubules and actin, and actin patches in the cortex. The conidiogenous mother cell developed a slender projection, or stalk, that contained cytoplasmic microtubules and actin cables stretched parallel to the longitudinal axis and actin patches accumulated in the tip. The conidium was produced on this stalk. It contained dispersed cytoplasmic microtubules, actin cables, and patches concentrated in the cortex. Before mitosis, the nucleus migrated through the stalk into the conidium and cytoplasmic microtubules were replaced by a spindle. Mitosis started in the conidium, and one daughter nucleus then returned to the mother via an eccentrically elongated spindle. The cytoplasmic microtubules reappeared after mitosis. A strong fluorescence indicating accumulated actin appeared at the base of the conidium, where the cytoplasm cleaved eccentrically. Actin patches then moved from the stalk together with the retracting cytoplasm to the mother and conidium. No septum was detected in the long neck by electron microscopy, only a small amount of fine "wall material" between the conidium and mother cell. Both cells developed a new wall layer, separating them from the empty neck. The mature conidium disconnected from the empty neck at the end-break, which remained on the mother as a tubular outgrowth. Asexual reproduction by conidiogenesis in the long-neck yeast F. fuzhouensis has unique features distinguishing it from known asexual forms of reproduction in the budding and fission yeasts. Fellomyces fuzhouensis develops a unique long and narrow neck during conidiogenesis, through which the nucleus must migrate into the conidium for eccentric mitosis. This is followed by eccentric cytokinesis. We found neither an actin cytokinetic ring nor a septum in the long neck, from which cytoplasm retracted back to mother cell after cytokinesis. Both the conidium and mother were separated from the empty neck by the development of a new lateral wall (initiated as a wall plug). The cytoskeleton is clearly involved in all these processes.

Actins↗

PubMed2006

Characterisation of the anticryptococcal effect of the FC-1 toxin produced by Filobasidium capsuligenum.

The basidiomycetous yeast Filobasidium capsuligenum produces a killer toxin (FC-1) which is highly effective against the opportunistic fungal pathogen Cryptococcus neoformans. The aim of this work was to study the effect of the toxin on C. neoformans cells. The sensitivities of strains representing eight molecular subtypes (VNI-IV and VGI-IV) of the C. neoformans species complex, and of an additional 50 clinical and environmental isolates were determined. Analysis of cellular DNA by laser scanning cytometry and fluorescein isothiocyanate (FITC) staining of the toxin-treated cells revealed that the killing mechanism of FC-1 is neither cell cycle- nor cell wall biosynthesis-dependent; rather it may act as an ionophoric protein that disrupts the cytoplasmic membrane function. The competition assay results suggest that beta-1,6-glucan in the cell wall may provide the binding site for the killer protein. This anticryptococcal toxin has the potential to be applied as a therapeutic agent for the treatment of cryptococcosis.

Animals↗

PubMed2005

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Animals↗

PubMed2004

Chemiluminescent visualization of superoxide generated by Candida albicans.

The high toxicity of reactive oxygen species (ROS) suggested a possible role in the pathogenicity of human pathogenic fungi. We previously reported a chemiluminescence method for measuring ROS generation in Candida albicans. In the present study, we attempted to visualize the ROS, superoxide anion radical (O2-), generated by paraquat (PQ)-stimulated C. albicans using methyl-Cypridina-luciferin analog (MCLA) as a chemiluminescence probe. Colonies of a wild-type C. albicans parent strain and its respiration-deficient mutant grown on agar plates were overlaid with a mixture of PQ and MCLA solutions. MCLA-dependent light emission from the colonies was recorded with a Hamamatsu ultralow-light-imaging apparatus with a CCD camera in a light-tight box. In the wild-type strain, marginal regions of growing colonies were strongly illuminated. The light emission from the colonies was extinguished by superoxide dismutase (SOD), proving that the light emission was strictly due to the superoxide anion. However, colonies of the respiration-deficient mutant poorly generated superoxide. Chemiluminecence measurements by a luminometer showed vigorous superoxide generation by the exponential phase cells of the parent strain but weak generation by the stationary phase cells. In the mutant, superoxide generation was weak compared with the parent strain. These results indicate that expansion of the colonies was due to the actively respiring cells located in the marginal regions. To our knowledge, the present report is the first chemiluminescent visualization of ROS including superoxide generated by C. albicans.

Candida albicans↗

PubMed2002

Chemiluminescence of superoxide generated by Candida albicans: differential effects of the superoxide generator paraquat on a wild-type strain and a respiratory mutant.

We previously reported that a respiration-competent parent strain (K) of Candida albicans was more susceptible to the intracellular superoxide radical (O2-) generator paraquat (PQ) than was a respiration-deficient mutant (KRD-19), although both showed a similar sensitivity to extracellularly generated O2-. To clarify the cause of the differential PQ lethality, we developed a chemiluminescence method for measuring O2- generated by C. albicans cells by using the probe methyl-Cypridina-luciferin analogue (MCLA), and examined the effects of PQ on O2- generation in both parent and mutant strains. Endogenous O2- generation without stimulation by PQ was unexpectedly low in both strains. PQ-induced O2- generation in the parent strain was maximal in logarithmic phase cells and lowered in stationary phase cells. In contrast, O2- generation in the mutant remained low throughout the growth phase, even when stimulated by PQ. The extent of PQ-induced O2- generation in the parent strain depended on the carbon source added to the assay mixture; in decreasing order, glucose, glycerol, no carbon source. The inhibitor of the cytochrome respiratory chain, antimycin A, suppressed almost completely the PQ-induced O2- generation in the parent strain. It has been established that PQ is converted to its radical form (PQ+) by receiving a single electron in cells. PQ+ then reduces molecular oxygen to O2- by redox cycling. Thus, the high tolerance to PQ of the respiration-deficient mutant can be explained by minimal PQ+/O2- production due to the limited supply of electrons from the impaired respiratory system.

Candida albicans↗

PubMed2001

Deficit in oxygen causes G(2) budding and unbudded G(2) arrest in Cryptococcus neoformans.

Cryptococcus neoformans exhibited diphasic growth when grown under limited aeration. First, it grew exponentially, but at OD 1, the concentration of dissolved oxygen in culture decreased to 1 mg l(-1) and a second phase of slow growth was started. This phase was characterized by a shift of budding from S to G(2), a sharp decrease in budding index and a sharp increase in the proportion of unbudded G(2) cells to 80%. Thus, a deficit in oxygen was demonstrated to delay the timing of budding, prolong the G(2) phase and cause accumulation of cells after DNA synthesis, but before commitment to budding.

Cell Cycle↗

PubMed2001

Bud emergence is gradually delayed from S to G2 with progression of growth phase in Cryptococcus neoformans.

The G2 index of the yeast Cryptococcus neoformans determined by laser scanning cytometer was 2-3 times higher than the budding index during transition to the stationary phase of the culture, indicating that buds emerged in the G2 phase of the cell cycle. To clarify whether buds also emerge in G2 during exponential growth of the culture, DNA content for each cell was measured with a fluorescence microscope equipped with a photomultiplier. The DNA content of cells having tiny buds varied rather widely, depending on growth phases and strains used. Typically, buds of C. neoformans emerged soon after initiation of DNA synthesis in the early exponential phase. However, bud emergence was delayed to G2 during transition to the stationary phase, and in the early stationary phase budding scarcely occurred, although roughly half of the cells completed DNA synthesis. Thus, the timing of budding in C. neoformans was actually shifted to later cell cycle points with progression of the growth phase of the culture.

Cryptococcus neoformans↗

PubMed2001

Microtubules and actin cytoskeleton in Cryptococcus neoformans compared with ascomycetous budding and fission yeasts.

Actin cytoskeleton and microtubules were studied in a human fungal pathogen, the basidiomycetous yeast Cryptococcus neoformans (haploid phase of Filobasidiella neoformans), during its asexual reproduction by budding using fluorescence and electron microscopy. Staining with rhodamine-conjugated phalloidin revealed an F-actin cytoskeleton consisting of cortical patches, cables and cytokinetic ring. F-actin patches accumulated at the regions of cell wall growth, i. e. in sterigma, bud and septum. In mother cells evenly distributed F-actin patches were joined to F-actin cables, which were directed to the growing sterigma and bud. Some F-actin cables were associated with the cell nucleus. The F-actin cytokinetic ring was located in the bud neck, where the septum originated. Antitubulin TAT1 antibody revealed a microtubular cytoskeleton consisting of cytoplasmic and spindle microtubules. In interphase cells cytoplasmic microtubules pointed to the growing sterigma and bud. As the nucleus was translocated to the bud for mitosis, the cytoplasmic microtubules disassembled and were replaced by a short intranuclear spindle. Astral microtubules then emanated from the spindle poles. Elongation of the mitotic spindle from bud to mother cell preceded nuclear division, followed by cytokinesis (septum formation in the bud neck). Electron microscopy of ultrathin sections of chemically fixed and freeze-substituted cells revealed filamentous bundles directed to the cell cortex. The bundles corresponded in width to the actin microfilament cables. At the bud neck numerous ribosomes accumulated before septum synthesis. We conclude: (i) the topology of F-actin patches, cables and rings in C. neoformans resembles ascomycetous budding yeast Saccharomyces, while the arrangement of interphase and mitotic microtubules resembles ascomycetous fission yeast Schizosaccharomyces. The organization of the cytoskeleton of the mitotic nucleus, however, is characteristic of basidiomycetous yeasts. (ii) A specific feature of C. neoformans was the formation of a cylindrical sterigma, characterized by invasion of F-actin cables and microtubules, followed by accumulation of F-actin patches around its terminal region resulting in development of an isodiametrical bud.

Actin Cytoskeleton↗

PubMed2000

Simple detection method for distinguishing dead and living yeast colonies.

A rapid and simple assay was developed for detection of yeast colonies containing dying or dead cells. Methylene blue, phloxin B, rose bengal and trypan blue at concentrations of 5-10 micromol l(-1) were shown to stain non-viable cells in colonies of Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans and Filobasidium capsuligenum without staining or affecting the viability of living cells of the colonies.

Basidiomycota↗

PubMed2000

Inhibitory effect of essential oils on apical growth of Aspergillus fumigatus by vapour contact.

The inhibitory effect of seven essential oils on the apical growth of hyphae of Aspergillus fumigatus was studied using a bio cell tracer by vapour contact in a sealed vessel. Based on the inhibitory pattern, these essential oils were classified into three groups. The first group, composed of citron, lavender and tea tree oils, stopped the apical growth in a loading dose of 63 micrograms ml-1 air, but allowed the regrowth of the hyphae after removal of the vapour, indicating fungistatic action. The second group, consisting of perilla and lemon-grass oils, stopped the apical growth in a loading dose of 6.3 micrograms ml-1 air, and did not allow the regrowth after gaseous contact at 63 micrograms ml-1 air, indicative of fungicidal action. The third group, consisting of cinnamon bark and thyme oils, retarded the growth in a dose of 6.3 micrograms ml-1 air, stopped it in a dose of 63 micrograms ml-1 air, and incompletely suppressed regrowth of the hyphae. Gas chromatographic analysis revealed that vapours of essential oils were absorbed on fungal mycelia and agar medium most abundantly by the first group, followed by the second and third groups, reflecting the volatility of the respective groups. Suppression of the apical growth by vapour contact was ascribed to the direct deposition of essential oils on fungal mycelia, together with an indirect effect via the agar medium absorbed.

Aspergillus fumigatus↗

PubMed2000

Role of cell shape in determination of the division plane in Schizosaccharomyces pombe: random orientation of septa in spherical cells.

The establishment of growth polarity in Schizosaccharomyces pombe cells is a combined function of the cytoplasmic cytoskeleton and the shape of the cell wall inherited from the mother cell. The septum that divides the cylindrical cell into two siblings is formed midway between the growing poles and perpendicularly to the axis that connects them. Since the daughter cells also extend at their ends and form their septa at right angles to the longitudinal axis, their septal (division) planes lie parallel to those of the mother cell. To gain a better understanding of how this regularity is ensured, we investigated septation in spherical cells that do not inherit morphologically predetermined cell ends to establish poles for growth. We studied four mutants (defining four novel genes), over 95% of whose cells displayed a completely spherical morphology and a deficiency in mating and showed a random distribution of cytoplasmic microtubules, Tea1p, and F-actin, indicating that the cytoplasmic cytoskeleton was poorly polarized or apolar. Septum positioning was examined by visualizing septa and division scars by calcofluor staining and by the analysis of electron microscopic images. Freeze-substitution, freeze-etching, and scanning electron microscopy were used. We found that the elongated bipolar shape is not essential for the determination of a division plane that can separate the postmitotic nuclei. However, it seems to be necessary for the maintenance of the parallel orientation of septa over the generations. In the spherical cells, the division scars and septa usually lie at angles to each other on the cell surface. We hypothesize that the shape of the cell indirectly affects the positioning of the septum by directing the extension of the spindle.

Cell Division↗

PubMed2000

Malassezia pachydermatis isolated from a South American sea lion (Otaria byronia) with dermatitis.

A fungus was isolated from the skin of an Otaria byronia and from the water of the pool in which the animal was kept. It formed creamy colonies with soft texture on Dixon agar and grew well without supplements of long-chain fatty acids. Cells were ovoid to cylindrical in shape, budded from a broad base, and budded and divided at the same location. Thus, the isolate was identified as M. pachydermatis. We compared this very rare isolate from a marine mammal with four strains of M. pachydermatis using the freeze-etching electron-microscopy technique. The cells showed the same characteristic ring-swellings on the protoplasmic membrane on the neck site between the mother and the daughter parts, and the same accumulation of circumvallate bulgings in a small area near the straight sections of spiral grooves as four reference strains. Thus, in terms of morphology and ultrastructure, the isolate could be regarded as a typical M. pachydermatis.

Animals↗

PubMed2000

Cells of different ploidy are often present together in Cryptococcus neoformans strains.

We examined the ploidy of C. neoformans strains using both laser scanning cytometry and a fluorescence microscope equipped with a photomultiplier. Haploid strains consisted of normal-sized cells with a haploid DNA amount. In the cell population there were also large-sized cells with a diploid DNA amount. These large cells in haploid strains were isolated using a Skerman micromanipulator, cultivated, and were able to generate diploid clones. Even after only 3-5 transfers on slants, haploid cells were present in all the diploid clones examined. Conversely, haploid clones obtained by single-cell-isolation of normal-sized cells from haploid strains were also shown to contain diploid cells after 3-5 transfers. Fresh haploid isolates from the environment similarly contained diploid cells after 3-5 transfers. Thus, a cellular ploidy shift was shown to occur widely in C. neoformans strains.

Cryptococcus neoformans↗

PubMed1999

Cytochrome p450nor, a novel class of mitochondrial cytochrome P450 involved in nitrate respiration in the fungus Fusarium oxysporum.

Fusarium oxysporum, an imperfect filamentous fungus performs nitrate respiration under limited oxygen. In the respiratory system, Cytochrome P450nor (P450nor) is thought to catalyze the last step; reduction of nitric oxide to nitrous oxide. We examined its intracellular localization using enzymatic, spectroscopic, and immunological analyses to show that P450nor is found in both the mitochondria and the cytosol. Translational fusions between the putative mitochondrial targeting signal on the amino terminus of P450nor and Escherichia coli beta-galactosidase resulted in significant beta-galactosidase activity in the mitochondrial fraction of nitrate-respiring cells, suggesting that one of the isoforms of P450nor (P450norA) is in anaerobic mitochondrion of F. oxysporum and acts as nitric oxide reductase. Furthermore, these findings suggest the involvement of P450nor in nitrate respiration in mitochondria.

Aerobiosis↗

PubMed1999

Cloning and characterization of a gene (arpA) from Aspergillus oryzae encoding an actin-related protein required for normal nuclear distribution and morphology of conidiophores.

We have isolated the arpA gene from Aspergillus oryzae as a homologue of the Neurospora crassa ro-4 gene. In N. crassa, mutations in the ro-4 gene, which encodes a major component of the dynactin complex Arp1, causes curling of hyphae and abnormalities in nuclear distribution. The arpA gene contains two introns and encodes a polypeptide of 381 amino acids, with a 78% sequence identity to the N. crassa Arp1. Overexpression of the arpA gene causes a defect in nuclear migration into elongating hyphae of germlings in A. oryzae. We constructed arpA disruptant strains of A. oryzae. The arpA null mutants showed poor growth and hyper-branched mycelia, as well as a nuclear distribution defect. Scanning electron microscopy revealed that the arpA null mutant has an aberrant conidiophore morphology with irregular phialides.

Actins↗

PubMed1999

Long-term observation on the changes of somatotopy in the facial nucleus after nerve suture in the cat: morphological studies using retrograde labeling.

To examine the time course of plasticity of the cranial nucleus during axonal regeneration, we followed the topographical reorganization of the cat facial nucleus (FN) up to 24 months after facio-facial nerve suture using retrograde labeling methods. The trunk of the temporal-zygomatico-orbital and both superior and inferior buccolabial branches (defined as main branch) of the facial nerve was cut and sutured again under ketamine hydrochloride anesthesia. At 11-722 days after nerve suture, Fast Blue (FB) and 1,1'-dioctadecyl-3, 3, 3', 3'-tetramethylindocarbocyanine perchlorate (Dil) or horseradish peroxidase (HRP) were injected into the distal part of the sutured main branch and the unoperated posterior auricular branch, respectively. Until about 3 months after suture, the topographical pattern in FN was similar to that observed in normal cats. At about 4 months after suture, FB-labeled motoneurons were distributed not only in the lateral part (including intermediate, dorsal and ventrolateral divisions) but also in the medial subdivision of FN. After a survival period of 18-24 months, FB-labeled neurons were found all over the FN, and their number increased significantly. Interestingly, in the longer survival cases, we noticed that the Dil- or HRP-labeled posterior auricular branch motoneurons also showed a tendency to distribute outside the medial region. The present study showed that somatotopic disorganization starts at around 4 months after suture, which seems to be somewhat slower than that in rats, and continues until a much later postoperative period. Furthermore, we suggested a possibility that the regeneration of one branch may affect the somatotopy of the unoperated nerve branch. These phenomena may contribute to aberrant facial nerve functions such as abnormal associated movement and facial spasm observed after nerve injury.

Amidines↗

PubMed1999

Enhancement of the growth of Helicobacter pylori in Brucella broth by hydrogen peroxide.

We found that a sub-lethal concentration of hydrogen peroxide (HPOx) enhanced the growth of Helicobacter pylori in Brucella broth supplemented with 10% fetal bovine serum (BB/FBS). The enhancement was evident at 0.1 mM HPOx and reached a maximun at 3.5 mM. The growth stimulation was dependent on the basal media used; when brain heart infusion broth (BHIB) was used instead of BB, the growth was not altered regardless of the presence or absence of HPOx. Furthermore, the growth in BHIB/FBS was comparable to that in BB/FBS plus 3.5 mM HPOx. This suggested that the enhancement of growth by HPOx resulted from the derepression of the inhibitory factor existing in BB by HPOx. The inhibitory substance seemed to be bisulfite salt since the bacteria grew to a similar extent in bisulfite-less Brucella broth (BLBB0)/FBS compared to the bacterial growth in BHIB/FBS and BB/FBS plus HPOx. These results indicate that the detoxification of bisulfite in BB can be easily achieved by simply adding HPOx to the medium, which causes the oxidation of bisulfite to bisulfate, a less-toxic compound to the bacterial growth. Since we also found that the morphology and cellular protein profile of BB/FBS-cultured bacteria were apparently different from those cultured in BLBB/FBS, we propose that the use of BB for primary isolation and cultivation of H. pylori should be limited on certain occasions, or if necessary, BB can be used after detoxification of the bisulfite by the addition of a low concentration of HPOx.

Bacterial Proteins↗

PubMed1998

Affinity electrophoresis and its applications to studies of immune response.

Affinity electrophoresis (AEP) is a useful technique for separation of biomolecules such as plasma proteins, enzymes, nucleic acids, lectins, receptors, and extracellular matrix proteins by specific interactions with their ligands in electric fields and for the determination of dissociation constants for those interactions. Two-dimensional affinity electrophoresis (2-D AEP), which was newly developed by a combination of isoelectric focusing with AEP, has been used for studies on immune response to haptens. Antihapten antibodies, which were induced by immunization of a mouse with the hapten-conjugated bovine serum albumin, were separated by 2-D AEP into a large number of groups of IgG spots with a few microliters of antiserum. Each group of spots showed an identical affinity for the hapten but different isoelectric points as in the case of monoclonal antibodies specific to the hapten. This enabled us to study the diversification and affinity maturation of antihapten antibodies in the course of immunization of a single mouse. Furthermore, effects of a carrier and a hapten array on the production of antihapten antibodies and the cause of charge heterogeneity of monoclonal antibodies were also examined to understand the molecular basis of the immune response in vivo.

Animals↗