Search PubMed⌕ Search

Biomedical subjects

K Tajima

Publications and source records attributed to K Tajima.

At least 163 records · Page 9Linked to original sources
PubMed1999

[Epidemiological study on HIV/AIDS in Cambodia seroprevalence of HIV/STD among commercial sex workers].

OBJECTIVE: To describe epidemiological features of HIV prevalence among female commercial sex workers (CSWs) in Cambodia, a cross-sectional study using a questionnaire study and serological tests was carried out from December 1997 to January 1998. We report the main results of the analyses of serological tests in this article. METHODS: Two hundred ninety six CSWs working in Sisophon and Poi Pet, located in northwest Cambodia, Bantey Mean Chey province, were recruited for interview based on a questionnaire on sexual behavior, and serological tests. The blood samples were examined for HIV antibody, Chlamydia trachomatis IgG antibody, TPHA, Hepatitis B surface antigen, and Hepatitis B surface antibody. The relationship between HIV and the other STD's was analyzed by using logistic regression analysis. RESULTS: The HIV seroprevalence rate was 43.9% (130 out of 296). The seropositive rate of Chlamydia trachomatis IgG antibody (C.T.-IgG-Ab) was 73.3% (217 out of 296). Logistic regression analysis showed a significant association between C.T.-IgG-Ab positive and HIV prevalence. (Odds Ratio: 5.33; 95% Confidence Interval, 2.82-10.07). CONCLUSIONS: This study suggests that the existence of Chlamydia trachomatis is closely related with HIV prevalence among CSWs in Cambodia. Other STDs may also increase susceptibility to male-to-female sexual transmission of HIV. This suggests that appropriate prevention against STDs will be needed for the control of HIV prevalence in Cambodia.

Acquired Immunodeficiency Syndrome↗
PubMed1999

[Relationship between regular exercise and life style, social network, education and subjective symptoms in Japanese middle aged and elderly residents].

OBJECT AND METHODS: A community-based survey of 12,630 residents of Gunma Prefecture aged 40 to 69 years was conducted to investigate the relationship between the habit of regular exercise and life style, social network, and subjective physical and mental symptoms in particular. The subjective physical and mental symptoms were measured using the Todai Health Index (THI). The response rate was 91.6%. A total of 6,736 responses were analyzed after excluding respondents with chronic diseases from the analysis. On the question about the habit of regular exercise ("Do you exercise regularly?"), the responses were divided into three categories: 1. Often, 2. Sometimes, 3. Hardly ever or Never. RESULTS AND CONCLUSION: The results are summarized as follows: 1. The proportions of residents who exercise "often" were 14.2% and 11.1% for males and females, respectively, while those of "hardly ever or never" were 52.3% and 59.4% for males and females, respectively. More males than females had the habit of regular exercise. Respondents were divided into three age categories: 40-49, 50-59 and 60-69 years. Among the female respondents, it was shown that the older the age category the greater the habit of regular exercise. 2. Both male and female respondents who had regular exercise habits scored significantly lower on the THI scales for vague complaints, depression, and irregularity of life, while they scored higher on the aggression and lie (social desirability) scales. 3. Both male and female respondents who had regular exercise habits also tended to have be better perceived health and social networking, i.e. having close friends, having a hobby and involvement in community social activities, as well as taking care of pets. This group also had a higher average education level and less of a smoking habit. This study suggests that regular exercise habit correlates not only with physical health and fitness levels but with mental health status as well.

Adult↗
PubMed1999

Transaortic approach for a closure of a residual ventricular septal defect of the tetralogy of Fallot.

BACKGROUND: A residual ventricular septal defect as part of the tetralogy of Fallot (TOF) is often difficult to close when a long interval has elapsed after a radical operation or the position of the defect is problematic. METHODS: When an accurate diagnosis and closure of a residual ventricular septal defect (VSD) were not obtainable through right atriotomy and right ventriculotomy, the ascending aorta was opened. The smooth surface of the left ventricular septum makes it possible to find the position of the defect, and close it accurately and safely. RESULTS: Three consecutive patients were operated upon using this method. They had undergone repair of tetralogy of Fallot anomalies 8 years, 26 years, and 21 years prior to this surgery, respectively. All patients survived the operation and were discharged from the hospital. None of the patients had residual defects, aortic regurgitation, or new atrioventricular block. CONCLUSIONS: This transaortic approach for closing residual ventricular septal defects related to the tetralogy of Fallot offers an alternate method when either the right atrial or right ventricular approach cannot be performed successfully. This approach may make it possible to close such defects directly.

Adult↗
PubMed1999

[Risk of death by health habit index from a cohort study among the residents of a rural area in Aichi, Japan].

To clarify the validity of the health habit index, we evaluated risk of death by health habit index in residents in Aichi Prefecture. Subjects were 7,662 residents aged 40-79 years living in a rural area of Aichi Prefecture who responded to a questionnaire in 1988, that included 12 health habit items on diet, physical activity, rest, mental health, smoking, drinking and regular health check. Data on death and migration in this cohort group was collected from 1990 to 1997. The risk ratios (RRs) of death for all causes, cancer and cardiovascular diseases were estimated by Cox's proportional hazard model. The number of all causes of death, cancer and cardiovascular diseases was 650, 240 and 197, respectively. Proper health habits of adequate but not over eating, regular physical activity, properly managing stress, non-smoking or smoking cessation for one year or more and regular health examinations in men and regular physical activity and non-smoking in women related to lower age-adjusted RR of death for all causes, while smoking cessation of less than one year in men with increased RR. Lower RR of cancer was observed for non-smoking men, and for women who occasionally have enough sleep. Proper health habits on adequate but not overeating, enjoying mealtime, regular physical activity, properly managing stress, moderate drinking (< 2 "go"/day) or occasional heavy drinking and regular health examinations related to lower RR of cardiovascular diseases in men, while regular physical activity related to lower RR in women. Multivariate analysis for the RR of death for all causes showed similar results, except higher RR in the men who avoided excess salt consumption, and decreased RR in the women who occasionally have enough sleep. In conclusion, the present study suggested that regular physical activity is associated with decreased risk from death for all causes, especially for cardiovascular diseases. Health habit index in the present study included various items with or without association to risk for death. It is important to apply this index to health promotion on the basis of its specific characteristic.

Adult↗
PubMed1999

[A case of sacral chordoma presenting as urinary retention].

A 71-year-old man was referred to our hospital complaining of urinary retention. He noticed a small mass on his buttocks about one year ago. Computed tomographic (CT) scan and magnetic resonance imaging (MRI) showed a large mass of 10 cm in diameter located in the retrovesical space. The mass extended to the surface of his buttocks and contained many calcified deposits, and was accompanied with a sacral bone fracture. Transdermic biopsy revealed the presence of sacral chordoma. Chordoma is a rare tumor, arising from remnants of the notochord and is locally progressive. Both tumor resection and diverting colostomy were performed at another hospital. In that operation his spinal cord was protected down to the second sacral level. Unfortunately after the operation, the patient suffered total urinary incontinence. At 15 months after surgical treatment, the patient presented with lung and bone metastases, and at 2 years after his initial operation, he had local recurrence.

Aged↗
PubMed1999

hOGG1 Ser326Cys polymorphism and lung cancer susceptibility.

The human homologue of the yeast OGG1 gene, hOGG1, has been cloned, and its genetic structure has been determined. Several polymorphisms in the hOGG1 gene were detected in the Japanese populations, and among them, the Ser-Cys polymorphism at codon 326 has been shown to have a functional difference in complementation of mutant Escherichia coli that is defective in the repair of 8-hydroxyguanine. Activity in the repair of 8-hydroxyguanine is greater in hOGG1-Ser326 protein than in hOGG1(326) protein. Because many environmental carcinogens produce 8-hydroxyguanine residue and mismatching to this modified base potentially causes oncogenic mutations, the capacity to repair these lesions can be involved in cancer susceptibility in human beings. We, therefore, examined allele distributions of the Ser326Cys polymorphism in a case-control study of male lung cancer in Okinawa. The analyses based on 241 cases and 197 hospital controls disclosed the following findings. (a) Those with the Cys/Cys genotype were at an increased risk of squamous cell carcinoma and nonadenocarcinoma compared to those with the Ser/Cys and those with the Ser/Ser genotypes combined. The odds ratios adjusted for age and smoking history were 3.01 (95% confidence interval, 1.33-6.83) and 2.18 (95% confidence interval, 1.05-4.54), respectively. (b) The odds ratios for other histological subtypes of lung cancer or those in total were not significant. Those for Cys/Cys or Ser/Cys genotype against Ser/Ser did not reach statistical significance in any cell type. (c) The distributions of this polymorphism varied for different populations (Chinese, Japanese, Micronesians, Melanesians, Hungarians, and Australian Caucasians), with much less prevalence of Cys allele in the latter three populations. Although our sample size was limited, these results indicate that the Ser326Cys variant may be related to squamous cell lung cancer susceptibility. The Cys/Cys genotype appears to be more susceptible to squamous cell carcinoma, although the risk is less than that previously reported to be associated with the CYP1A1 gene. Further studies are needed to assess the importance of the interpopulation variation to cancer susceptibility.

Adult↗
PubMed1999

A seroepidemiological survey of HTLV-I/II carriers in the Puna Jujeña.

Human T-cell leukemia virus type I (HTLV-I) carriers are clustered in limited groups in the world. One of these groups is the Andean native population of South America. As part of an international collaborative study devoted to explore the clustering of HTVL-I carriers in different countries, the aim of this paper was to evaluate the seroprevalence of HTLV-I/II virus in the native population of Puna Argentina in Jujuy. Blood samples of individuals of three populations of Puna Jujeña (Susques, Rinconada, Cochinoca) were screened with particle agglutination (PA), immunofluorescence (IF) and western immunoblotting analysis (WB) tests. Two out 86 (2.32%) individuals examined in the Puna Jujeña showed positive results for HTLV-I antibodies. It is concluded that the Province of Jujuy, in particular its less miscegenated highest altitude areas, constitute the northern and southern Andean natural geographical clustering of HTLV-I. This distribution is probably linked both to a history of prehistoric human dispersal in the Andes and to high mother- to-child transmission of the virus under close conditions of each group.

Adult↗
PubMed1998

1H nuclear magnetic resonance study on equilibrium between two four-stranded solution conformations of short d(CnT).

NMR analysis of d(C4T) showed the slow exchange between two distinct tetramers (each fully symmetric) in solution. For one tetramer, NOE cross-peak patterns characteristic of an i-motif structure (H1'-H1' and H6-H1'/H1'-H6) were observed between C1 and T5, indicating that this tetramer takes a completely intercalated conformation where the T5 residue is stacked on the C1.C1(+) pair of the other duplex (S-form). The other was found to be a tetramer in which one of the duplexes is shifted by one nucleotide unit (R-form), resulting in nonstacking 3' end thymidine residues and an equal number of stacked C.C+ pairs to that of the S-form. The same spectral features were observed for d(C3T) but neither for d(TC3) nor d(TC4), indicative of the critical role of the position of the thymidine residue in the tetrad isomerization. From NMR denaturation profiles, the S-forms were found to be more stable than the R-forms, and the linear relationship between the logarithm of the equilibrium constant (K = [tetramer]/[single]4) and the inverse of temperature (1/T) was confirmed for both forms, indicating conformity to the two-state transition model. Both enthalpy and entropy values of the formation of the S-form from four single strands were more negative than those of the R-form. The enthalpy term should contribute to the stabilization of the S-forms at low temperatures. The difference of the free energy values [DeltaG degrees(S-form) - DeltaG degrees(R-form)] was found to be -2.1 and -2.7 kJ.mol-1 at 20 degreesC for d(C4T) and d(C3T), respectively, explaining the higher stability of the S-forms. With increasing temperature, these two topologies were found to comparably exist at equilibrium in solution with slow exchange via dissociation to the single strands. A biological role of this topological isomerization is also suggested.

Base Composition↗
PubMed1998

Misincorporation of 2'-deoxyoxanosine 5'-triphosphate by DNA polymerases and its implication for mutagenesis.

2'-Deoxyoxanosine (dOxo) is a novel DNA lesion produced by the reaction of 2'-deoxyguanosine (dGuo) with nitrous acid and nitric oxide [Suzuki, T., Yamaoka, R., Nishi, M., Ide, H., and Makino, K. (1996) J. Am. Chem. Soc. 118, 2515-2516]. In this work, 2'-deoxyoxanosine 5'-triphosphate (dOTP) was prepared by nitrous acid treatment of 2'-deoxyguanosine 5'-triphosphate (dGTP), and its incorporation into DNA by DNA polymerases was investigated to elucidate the substrate and mutagenic properties of dOTP. Primed M13mp18 DNA was replicated by Escherichia coli DNA polymerase I Klenow fragment (Pol I Kf) in the presence of three normal dNTPs and dOTP or 2'-deoxyxanthosine 5'-triphosphate (dXTP), another major product of reaction of dGTP with nitrous acid and nitric oxide. dOTP substituted for dGTP and to a lesser extent for dATP, while dXTP substituted slightly for dGTP but not for dATP. Neither dOTP nor dXTP substituted for dCTP and dTTP. The similar results were obtained for the incorporation by T7 DNA polymerase deficient in 3'-5' exonuclease [T7(exo-)]. To quantify the substitution efficiency, kinetic parameters for incorporation of dOTP and dXTP opposite template C or T by Pol I Kf (exo-) were determined and compared with those for dGTP using oligodeoxynucleotide templates. Incorporation efficiencies (f = Vmax/Km) of dOTP (f = 0.28% min-1 microM-1) and dXTP (f = 0.10% min-1 microM-1) opposite template C were much lower than that of dGTP (f = 1506% min-1 microM-1). Frequencies of mutagenic incorporation of dOTP opposite template T were dependent on the nearest neighbor base pairs, and 1.6-3.9-fold higher than those for dGTP with the nearest neighbors containing G.C pairs. dXTP was not incorporated opposite template T with all four nearest neighbors. These data suggest that formation of dOTP, but not dXTP, from dGTP with nitrous acid or nitric oxide in the intracellular nucleotide pool would result in the elevation of the mutation frequency.

Anti-Bacterial Agents↗
PubMed1998

Structural Characterization of an Octadecylamine Langmuir-Blodgett Film Adsorbed with Methyl Orange.

The adsorption characteristics of a Langmuir-Blodgett (LB) film of octadecylamine (ODA) transferred from the surface of an alkaline subphase were investigated by employing dye material of methyl orange (MO) as an adsorbate. As a result, specific adsorbability of the ODA LB film was observed, similarly to that of the LB film of long-chain quaternary alkylammonium salt. The structural characterizations of the ODA LB films before and after MO adsorption were also carried out by applying spectroscopic methods. It was found that the MO molecules took the specific molecular arrangements of edge-on orientation on the LB film and that the bilayer in the LB films had an interdigitated structure. Furthermore, the layer-layer distance of the LB film was fairly decreased by the MO adsorption, indicating the formation of another layer structure. Copyright 1998 Academic Press.

Journal Article↗
PubMed1998

Family history and subsite of gastric cancer: data from a case-referent study in Japan.

A comparative case-referent study was conducted using data from the Hospital-Based Epidemiologic Research Program at Aichi Cancer Center (HERPACC) (Nagoya, Japan), with the aim of clarifying the effect of family history on gastric cancer by subsite. Our study comprised 995 histologically confirmed gastric cancer cases (180 cardia, 430 middle, 365 antrum and 20 unclassified) and a total of 43,846 non-cancer outpatients at Aichi Cancer Center Hospital between 1988 and 1995. Logistic regression was used to calculate odds ratios (ORs) for family history of gastric cancer and other cancers, adjusted for age, year and season at first hospital visit, habitual smoking, habitual alcohol drinking, regular physical exercise, preference for salty food and raw vegetable intake. In both genders, a positive family history of gastric cancer was associated with a moderate, but statistically significant increase in risk of gastric cancer [OR = 1.51, 95% confidence interval (95% CI) = 1.29-1.76], while no association was observed between the risk of gastric cancer and a family history of other cancers [OR = 0.97, 95% CI = 0.84-1.13]. OR increased for the middle and antrum parts of gastric cancer, but an increment for the cardiac part was observed only in those with a maternal history of gastric cancer. Our results suggest that the risk of gastric cancer in relation to family history varies by subsite and, furthermore, that the subsite-specific risk of gastric cancer is linked to a maternal history of gastric cancer.

Adult↗
PubMed1998

Long acellular nerve transplants for allogeneic grafting and the effects of basic fibroblast growth factor on the growth of regenerating axons in dogs: a preliminary report.

Sciatic nerves were excised from 3 beagle dogs about 5 h after their sacrifice, treated three times by freezing and thawing, and stored in physiological saline for 3 months at -20 degrees C until used. Nerve segments 5 cm in length prepared from these stored nerves were transplanted to the common peroneal nerve in the right hindlimb of beagle dogs. Sixteen beagle dogs in total were used, in four treatment groups of two pairs each studied at 1 and 3 months. Five-hundred microliters basic fibroblast growth factor (bFGF) of two different concentrations (10 micrograms/300 microliters and 100 micrograms/300 microliters) which were impregnated in 0.5 ml gelatin hydrogels was applied around the sutured allografts. Autografting was also done in 4 beagle dogs, with no bFGF application. One month after the grafting, no regenerating nerves extended beyond the middle of the transplant in any of the allografts, except in the autografts in which a number of regenerated (myelinated) axons were present. Three months after the grafting, an abundance of myelinated axons was found at the middle of the graft: the numbers of axons per 10(4) micron 2 were 22.6 in the autografts and 10.6, 10.4 and 19.2 in the allografts treated with no bFGF, low-dose bFGF, and high-dose bFGF, respectively. Regenerating axons extended into the host nerve: the numbers of myelinated axons at the level 1.5 cm distal to the distal suture were 35.7, 0.9, 3.8, and 12.1 per 10(4) micron 2 in the above respective order. Although it was inferior in quality to the autograft, peripheral nerve regeneration was extensive in the distal nerve using freeze-thawed and bFGF-treated allografts at 3 months. Electromyography showed that the peroneus longus muscle responded to the electrical stimuli given at the site proximal to the transplant in all four groups. These data indicate that a 5-cm acellular nerve segment containing Schwann cell basal laminae can be used successfully as an allograft without any immunosuppressants and that exogenously applied bFGF can improve nerve regeneration by enhancing the growth of regenerating axons.

Animals↗
PubMed1998

Transcriptional regulation of the Prevotella ruminicola recA gene.

The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level. P. ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region. At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents, mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress. No induction was detected when growth of P. ruminicola was arrested by shifting to acidic (pH 4.8) conditions. Primer extension experiment revealed the three very close transcriptional start sites for recA. The putative -10 and -35 RNA polymerase binding regions were proposed on the basis of transcript mapping. These regions bear very little similarity to the E. coli (sigma70) and B. subtilis (sigmaA) consensus sequences, as well as to the recognition sites of other minor sigma-factors. Transcript mapping experiments in E. coli expressing P. ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription. Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative -10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P. ruminicola. This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E. coli and other Gram-negative bacteria.

Animals↗
PubMed1998

Cellular localization of interleukin-5 expression in rectal carcinoma with eosinophilia.

Eosinophilia often occurs in malignant diseases. This report concerns a female patient aged 76 years, diagnosed with rectal carcinoma with eosinophilia. Sera were obtained at two different periods (at diagnosis and after the operation) for the evaluation of levels of interleukin-5 (IL-5). The serum IL-5 level increased to 264 pg/mL, and returned to an undetectable level after the operation. The serum at diagnosis enhanced the viability of normal eosinophils in vitro, and this activity was inhibited by antihuman IL-5 polyclonal antibody. Immunohistochemistry and in situ hybridization revealed that stromal eosinophils contained IL-5 protein and messenger RNA (mRNA), but no IL-5 transcripts were detected in eosinophils attached to carcinoma cells. In situ detection of apoptosis showed that several eosinophils attached to tumor cells underwent apoptosis and lost their eosinophil secreted cationic protein (ECP) and major basic protein (MBP). These results may suggest that activated eosinophils by IL-5 play an important role in host defense mechanisms, releasing their toxic granule proteins on adjoining tumor cells.

Adenocarcinoma↗
PubMed1998

Tea and coffee consumption and the risk of digestive tract cancers: data from a comparative case-referent study in Japan.

OBJECTIVES: The purpose of this study was to examine the hypothesis that tea and coffee consumption have a protective effect against development of digestive tract cancers. METHODS: A comparative case-referent study was conducted using Hospital-based Epidemiologic Research Program at Aichi Cancer Center (HERPACC) data from 1990 to 1995 in Nagoya, Japan. This study comprised 1,706 histologically diagnosed cases of digestive tract cancers (185 esophagus, 893 stomach, 362 colon, 266 rectum) and a total of 21,128 non-cancer outpatients aged 40 years and over. Logistic regression was used to analyze the data, adjusting for gender; age; year and season at hospital-visit; habitual smoking and alcohol drinking; regular physical exercise; fruit, rice, and beef intake; and beverage intake. RESULTS: The odds ratio (OR) of stomach cancer decreased to 0.69 (95 percent confidence interval [CI] = 0.48-1.00) with high intake of green tea (seven cups or more per day). A decreased risk was also observed for rectal cancer with three cups or more daily intake of coffee (OR = 0.46, CI = 0.26-0.81). CONCLUSIONS: The results suggest the potential for protective effect against site-specific digestive tract cancer by consumption of green tea and coffee, although most associations are limited only to the upper category of intake and have no clear explanation for site-specificity.

Adult↗
PubMed1998

Inhibition of stress-stimulated colonic propulsion by alpha 2-adrenoceptor antagonists in rats.

Alpha2-adrenoceptor antagonists have been reported to stimulate colonic motor activity, but the effect on colonic motor dysfunction is unclear. We have investigated the effect of alpha 2-adrenoceptor antagonists on wrap-restraint stress-stimulated and normal colonic propulsion in rats. Colonic propulsion was evaluated by the transit of a charcoal marker along the colon. Faecal pellets output was also measured. A 30-min exposure to wrap-restraint stress starting 120 min after infusion of the charcoal marker significantly stimulated colonic transit with a concomitant increase in faecal pellets. Yohimbine and idazoxan, alpha 2-adrenoceptor antagonists, clonidine, an alpha 2-adrenoceptor agonist, and atropine suppressed wrap-restraint stress-stimulated colonic transit and faecal excretion in a dose-dependent manner. Ondansetron and YM060, 5-hydroxytryptamine3 (5-HT3) receptor antagonists, potently inhibited wrap-restraint stress-stimulated colonic transit, but only weakly inhibited faecal excretion. Neither alpha 2-adrenoceptor antagonists nor atropine had any significant effect on normal colonic transit, whereas clonidine and the 5-HT3 receptor antagonists inhibited it. alpha 2-Adrenoceptor antagonists as well as clonidine, atropine and 5-HT3 receptor antagonists inhibit the stress-induced colonic motor dysfunction in rats.

Adrenergic alpha-Agonists↗
PubMed1998

Effect of ultrafiltration during cardiopulmonary bypass for pediatric cardiac surgery.

The effect of ultrafiltration during cardiopulmonary bypass (CPB) was evaluated for correcting ventricular septal defects with associated pulmonary hypertension in patients less than 18 months old. Interleukin (IL)-6 and IL-8 concentrations in the blood, ultrafiltrate, and urine were measured. The blood IL-6 concentration increased to 128.4+/-20.2 pg/ml by the end of surgery, which is lower than the concentration seen in adult patients (273.1+/-48.2 pg/ml, p < 0.02). The blood IL-8 concentration was not significantly different than that of adults. The total amounts of excreted IL-6 in the ultrafiltrate and urine during CPB were 11.5+/-0.32 pg/kg and 0.32+/-0.07 pg/kg, respectively (p < 0.05). The total amounts of excreted IL-8 in the ultrafiltrate and urine were 4.64+/-0.69 pg/kg and 1.92+/-0.56 pg/kg, respectively (p < 0.05). No differences were seen in these values for excretion between children and adults. We conclude that ultrafiltration during CPB in pediatric patients is more effective in removing proinflammatory cytokines than in adults and more effective than renal filtration alone.

Cardiopulmonary Bypass↗