Biomedical subjects

K Sun

Publications and source records attributed to K Sun.

At least 91 records · Page 5Linked to original sources

PubMed1999

[Changes of serum biochemical parameters during hypothermia and hypoxia in rats].

OBJECTIVE: To study the effects of hypothermia and hypoxia on serum biochemical parameters. Method Acute hypobaric hypoxia experiment in cold environment was carried out in 48 healthy Wistar rats to observe changes of hepatic, cardiac and renal functions. RESULT: Hepatic, cardiac and renal functions changed non-prominently after acute hypoxia exposure under cold condition. Under hypoxic exposure of the same degree, serum lactic dehydrogenase(LDH), alanine transaminase(ALT), blood urea nitrogen (BUN) and creatinine (Cr) increased more significantly at 10 degrees C than those at 20 degrees C (P < 0.01) while creatine kinase (CK) decreased significantly at 10 degrees C than that at 20 degrees C. CONCLUSION: After acute hypoxia in cold environment, the changes in cardiac function did not simply equal to the changes by cold environment plus changes by acute hypoxia.

Alanine Transaminase↗

PubMed1999

Enhancing effects of silkworm expressed recombinant human macrophage colony-stimulating factor on hematopoietic recovery of irradiation-injured mice.

OBJECTIVE: To study the hematopoietic enhancing effects of recombinant human macrophage colony-stimulating factor (rhM-CSF) expressed in silkworm. METHOD: Balb/c mice were irradiated with sublethal dose of 60 Co gamma-rays and then administered intraperitoneally with silkworm expressed rhM-CSF (1000 U per individual for 7 days) in treatment group or with normal saline (for 7 days as well) in control group. The hematopoietic recovery of irradiation mice was observed by comparing peripheral white blood cell (WBC) counts, differential counts of WBC and bone marrow hematopoietic progenitor cell colony forming assay in soft agar at different time after irradiation. RESULTS: The total WBC counts (x 10(9)/L) of treatment group at day 15 and 20 after irradiation(3.42 +/- 1.20, 5.56 +/- 2.50, respectively) were significantly higher than those of control group (2.03 +/- 0.90, 3.72 +/- 2.30; both P < 0.05). On days 10, 15, 20, 25 and 30 after irradiation, the monocyte counts (x 10(9)/L) of treatment group (0.08 +/- 0.06, 0.16 +/- 0.10, 0.48 +/- 0.35, 0.47 +/- 0.21 and 0.33 +/- 0.17, respectively) were all significantly higher than those of control group (0.025 +/- 0.016, 0.05 +/- 0.04, 0.23 +/- 0.16, 0.33 +/- 0.19 and 0.17 +/- 0.13; all P < 0.05). On days 15, 20 and 25, the granulocyte count (X 10(9)/L) of treatment group (1.03 +/- 0.61, 2.18 +/- 1.19 and 3.28 +/- 1.09) were also higher than those of control group (0.62 +/- 0.37, 1.40 +/- 0.99 and 2.20 +/- 0.74; all P < 0.05). On day 9 after irradiation, the bone marrow CFU-GM yield of control group (19 +/- 11/10(6) cells) was significantly lower than that of treatment group (78 +/- 30/10(6) cells, P < 0.05). CONCLUSION: rhM-CSF expressed in silkworm could accelerate hematopoietic recovery in irradiated mice.

Animals↗

PubMed1999

Allele loss on chromosome 9q22.2-22.3 in sporadic basal cell carcinoma in Chinese.

OBJECTIVE: To investigate the role of allele loss on chromosome 9 in the pathogenesis of basal cell carcinoma (BCC) by examining the loss of heterozygosity in sporadic basal cell carcinoma and other cutaneous tumors. METHODS: DNA samples were isolated from the tumors, the matched adjacent normal skin and the blood of patients with sporadic basal cell carcinoma (14), squamous cell carcinoma (25) and Bowen's disease (5) by phenol-chloroform extraction. In our study, we used two microsatellite markers on chromosome 9, one was locus D9S319 (9p21), and the other was D9S299 (9q22.2-22.3). After PCR was performed, the samples were electrophoresed through 5% denatured polyacrylamide gels which were dried and exposed to Fuji XR films. RESULTS: Loss of heterozygosity with D9S319 (9p21) marker was not observed in the 10 informative cases of sporadic basal cell carcinoma, 19 squamous cell carcinoma and 4 Bowen's disease. Allelic deletion of D9S299 was not seen in the 21 informative cases of squamous cell carcinoma and 4 Bowen's disease. D9S299 (9q22.2-22.3) allele loss occurred in 2 of the 10 informative cases of sporadic basal cell carcinoma, indicating that there might be a susceptible tumor suppressor gene on chromosome 9, and loss of this allele might play an important role in the development of basal cell carcinoma. Inactivation of Drosophila patch (PTCH) (MSSE gene ESS1) in BCC might be necessary, if not sufficient, for BCC carcinogenesis. CONCLUSION: Chromosome 9q22.2-22.3 may contain a putative tumor suppressor gene, and the loss of this gene may play an important role in the development of sporadic basal cell carcinoma.

Basal Cell Carcinoma↗

PubMed1999

[Effect of activated donor-type NK cells on allogeneic bone marrow transplantation in mice].

OBJECTIVE: To study the effect of activated donor-type NK cells on allogeneic bone marrow transplantation(BMT). METHODS: Four hours before or 72 hours after transfusing bone marrow cells(containing T cells), the activated donor-type NK cells were injected into tumor-bearing mice conditioned by irradiation. The effect of these NK cells were assessed by CFU-S, CFU-GM, survival, body weight, histopathology and lung metastases in the recipients. RESULTS: The transfusion of activated donor-type NK cells markedly increased CFU-S and CFU-GM numbers. When these NK cells were transfused 4 hours before BMT, they augmented GVT yet inhibited GVHD as evidenced by increases in survival duration and body weight, reduction in grade of histopathological changes and decrease in lung metastases. However, when activated donor-type NK cells were transfused 72 hours after BMT, they exacerbated GVHD. CONCLUSIONS: The activated donor-type NK cells could prevent GVHD and produce significant GVT effects and also resulted in greater hematopoietic reconstitution if they were at the initial stage of allogeneic BMT in mice. Thereafter, the activated donor-type NK cells were detrimental and could exacerbate the subsequent GVHD, these results also demonstrated that GVT and GVHD could be dissociable phenomena.

Animals↗

PubMed1999

[Experimental study of LAK and activated NK cells affecting hematopoiesis in mice].

OBJECTIVE: To study the relationship between LAK/activated NK cells and hematopoiesis as well as the effects of LAK/activated NK cells on hematopoietic reconstitution after syngeneic bone marrow transplantation(BMT) in mice. METHODS: 1. LAK/activated NK cells were cocultured with bone marrow cells(BMC) in semi-solid agar medium to determine their effects on CFU-GM formation. 2. Syngeneic LAK/activated NK cells were transferred with BALB/c BMCs into lethally irradiated syngeneic recipients to determine their effects on hematopoietic reconstitution. RESULTS: When BMC were cultured under optimal growth conditions in the presence of exogenous hematopoietic growth factors, the effects of LAK/activated NK cells were mainly inhibitory. However, when BMCs were cultured under growth-limiting conditions without exogenous hematopoietic growth factors, the LAK/activated NK cells could support CFU-GM formation. Syngeneic LAK/activated NK cells significantly increased CFU-S and CFU-GM numbers after syngeneic BMT, and also significantly improved platelet and white blood cell count. CONCLUSIONS: LAK/activated NK cells could be bidirectionally regulate CFU-GM formation in vitro and promote hematopoietic reconstitution after syngeneic BMT in mice.

Animals↗

PubMed1999

[The ultrastructure of membrane component in adenoid cystic carcinoma of salivary gland].

OBJECTIVE: To study morphological variations of basment membrane component (BMC) for determination of invasion and vascular metastasis in adenoid cystic carcinoma (ACC). METHODS: The BMC of 8 cases in ACC and 2 cases of normal parotid gland were observed by LM and EM. RESULTS: The BMC surrounding tumor mass and strands showed multi-layered or dissolution, pseudopodia were seen extended from tumor cells, and contained numerous microvesicles. If the tumor cell attached blood vessels, the collagenous fibril were dissoluted and BMC were lost. CONCLUSION: The tumor cell may release some digestive enzymes which may be able to dissolve BMC and collagenous fibrils and invade into blood vessels and metastasis take place.

Basement Membrane↗

PubMed1999

[The treatment of 432 patients with pituitary adenomas via transsphenoidal approach].

OBJECTIVE: To study some clinical features of 432 cases of pituitary adenomas treated by transsphenoidal microsurgery between July 1982 and October 1996. METHODS: Pathological examination, immunohistochemical examination and electronmicroscopic examination were done in 424, 29 and 103 cases respectively. RESULTS: Hyperprolactinemia was found in many so-called non-functioning adenomas besides in prolactinomas. The dura maters were invaded by tumors in 78 cases (the incidence of dural invasion was 65.5%). CONCLUSIONS: Hyperprolactinemia is not peculiar to prolactinomas, and differential diagnosis is necessary when hyperprolactinemia exists. The involvement of the dura mater of sellar floor is an important mark that the adjacent tissues were invaded by pituitary adenomas. The outcome of surgical treatment is significantly different between the patients with dural invasion and without invasion.

Adenoma↗

PubMed1999

[Partial gene clone and nif gene homologous sequence analysis of Streptococcus sanguis].

OBJECTIVE: To analyze the sequence of Streptococcus sanguis chromosome which contains one DNA fragment of 800 base pairs (bp) and discuss Streptococcus sanguis biological features of heredity. METHODS: Streptococcus DNA of 800-bp genetic fragment was cloned and analyzed by using eukaryotic expression vector. RESULTS: By Genbank database, it showed that the 800-bp genetic sequence was highly homologous with other bacterial nifS and nifU gene, and the highest homologous score was 114. CONCLUSION: This nif gene of ATCC 10556 strain may correlate with nutrient metabolism and peroxide hydrogen release of Streptococcus sanguis.

Cloning, Molecular↗

PubMed1999

[Preparation of Streptococcus sanguis DIG-labeled DNA probes and clinical application].

OBJECTIVE: To investigate oral Streptococci nif gene. METHODS: According to the 800 base pairs(bp) sequence, a couple of special prime was designed, which were 5'TAGTTGAAGCGATTAAAGCG 3' and 5' TCGTCGTGAAAGCCAAA 3'. DIG-labeled DNA probes of ATCC10556 800 bp DNA fragment and 559 bp DNA fragment were made. By using Southern blotting and dot blotting, more than 30 bacterial strains were checked. RESULTS: 559 bp sequence was according with the reported results, and the Southern blot results showed that S34 sr, S34 no 1 strains had homologicous sequence with ATCC10556, two strains of Streptococcus sanguis were weak positive, and other strains were negative. CONCLUSION: Streptococcus sanguis ATCC10556 strain contained exactly nif gene and nif gene may be the special gene of Streptococcus sanguis ATCC 10556.

Base Sequence↗

PubMed1999

[The detection and clinical significance of telomerase activity in supraglottic carcinomas].

OBJECTIVE: To study the expression and significance of telomerase activity in laryngeal carcinoma. METHOD: We detected telomerase activity of HEP-2 cell line, 26 cases of supraglottic carcinoma tissues and 15 cases of peri-carcinoma tissues with PCR-based assay designated TRAP (for telomeric repeat amplification protocol). RESULT: The telomerase positive rate of supraglottic carcinoma 84.6% (22/26) was obvious higher than that of peri-carcinoma 40% (6/15), P < 0.01. No significant differences in positive rates were found among different groups divided according to clinical stage or metastasis of cervical lymph node, P > 0.05. CONCLUSION: Telomerase activation is related to immortalization process, though not much helpful in diagnosis of supraglottic carcinoma.

Adult↗

PubMed1998

[Identification of adhalin gene mutation in limb-girdle muscular dystrophy in Chinese].

OBJECTIVE: Limb-girdle muscular dystrophy (LGMD) is a group of severe genetic heterogeneity muscular diseases characterized by proximal muscular weakness of the pelvis and shoulder, affecting both male and female. This group of diseases involves four gene loci (13q12, 17q21,4q12,5q33). Up till now there is no research report about LGMD in Chinese. This study was intended to identify the pathogenic genes of LGMD in Chinese by mutation detecting. METHODS: The exons 2 and 3 of adhalin gene were analyzed in 13 Chinese LGMD patients and 20 controls by using PCR-SSCP and DNA sequencing. RESULTS: The R77C (Arg77Cys) missense mutation was found at the two alleles of a 9-year-old LGMD girl, which had not been found in the 40 wild type chromosomes. This is the first report on adhalin mutation that exists in LGMD in Chinese. CONCLUSION: Our results suggest that adhalin gene is one of the predisposing genes in LGMD in Chinese.

Child↗

PubMed1998

Human genes for KNSL4 and MAZ are located close to one another on chromosome 16p11.2.

KNSL4 (Kid; kinesin-like DNA-binding protein) is a member of the kinesin family that is involved in spindle formation and the movements of chromosomes during mitosis and meiosis. Myc-associated zinc finger protein (MAZ) participates in both the initiation and the termination of transcription of target genes. We isolated genomic DNA clones that encoded KNSL4 and MAZ from a human cosmid library. Sequence analysis revealed that the two genes were very close to one another. The distance between the two genes was only 1. 2 kb, and this intervening 1.2-kb region was extremely GC-rich. The gene for KNSL4 spanned 16 kb and consisted of 14 exons and 13 introns, while the gene for MAZ spanned 6 kb and consisted of 5 exons and 4 introns. The two genes were mapped to chromosome 16p11.2 by fluorescence in situ hybridization.

Chromosome Mapping↗

PubMed1998

Genomic organization and expression of a human gene for Myc-associated zinc finger protein (MAZ).

We have cloned and characterized the genomic structure of the human gene for Myc-associated zinc finger protein (MAZ), which is located on chromosome 16p11.2. This gene is transcribed as an mRNA of 2.7 kilobases (kb) that encodes a 60-kDa MAZ protein. A 40-kb cosmid clone was isolated that includes the promoter, five exons, four introns, and one 3'-untranslated region. All exon-intron junction sequences conform to the GT/AG rule. The promoter region has features typical of a housekeeping gene: a high G + C content (88. 4%); a high frequency of CpG dinucleotides, in particular within the region 0.5 kb upstream of the site of initiation of translation; and the absence of canonical TATA and CAAT boxes. An S1 nuclease protection assay demonstrated the presence of multiple sites for initiation of transcription around a site 174 nucleotides (nt) upstream of the ATG codon and such expression was reflected by the promoter activity of a MAZ promoter/CAT (chloramphenicol acetyltransferase) reporter gene. Cis-acting positive and negative elements controlling basal transcription of the human MAZ gene were found from nucleotides (nt) -383 to -248 and nt -2500 to -948. Moreover, positive and negative autoregulatory elements were also identified in the regions from nt -248 to -189 and from nt -383 to -248 after co-transfection of HeLa cells with plasmids that carried the MAZ promoter/CAT construct and the MAZ-expression vector. Our results indicate that the 5'-end flanking sequences are responsible for the promoter activities of the MAZ gene.

Amino Acid Sequence↗

PubMed1998

Properties of aspartate transcarbamylase from TAD1, a psychrophilic bacterial strain isolated from Antarctica.

TAD1 is a psychrophilic strain isolated from continental frozen water in Antarctica. Study of aspartate transcarbamylase in the bacterium shows an impressive activity of this enzyme at low temperature. At 0 degree C, its activity is up to 26% of its maximal activity observed at 30 degrees C. In comparison with the Escherichia coli enzyme, some of its kinetic properties suggest that this high activity at low temperature results from an increased catalytic efficiency. This property might result from a discrete modification localized at the catalytic site, since this psychrophilic enzyme is as stable as its Escherichia coli homologue at high temperature.

Antarctic Regions↗

PubMed1998

Further analysis of interleukin-2 receptor subunit expression on the different human peripheral blood mononuclear cell subsets.

We have investigated the expression of the three components of the interleukin-2 receptor (IL-2Ralpha, IL-2Rbeta, and IL-2Rgamma) on the surface of the various peripheral blood mononuclear cell (PBMC) subsets by flow cytometry analysis. The PBMC were immediately isolated (ficoll) from blood collected on heparin as anticoagulant. The three IL-2R components are absent or only marginally detectable on CD4 T lymphocytes. No expression of the IL-2R chains is found for the B lymphocytes. In most donors, the three chains are not detectable on CD8 T lymphocytes, but for a few of them, IL-2Rbeta or IL-2Rgamma are clearly expressed. CD56 high (IL-2Ralpha+) and CD56 low (IL-2Ralpha-) natural killer (NK) cells express IL-2Rbeta, but not IL-2Rgamma. IL-2Rgamma is expressed by monocytes of all donors although with variable intensity. When blood is collected on other anticoagulants or when cells are isolated 1 day after collection, IL-2Ralpha, IL-2Rbeta, and IL-2Rgamma are largely expressed on the surface of most PBMC. This observation provides a possible explanation for divergent data previously reported on IL-2R expression. Finally, we show that IL-2Rgamma, which is not detectable on the cell surface of lymphocytes, is nevertheless expressed and stored as an intracellular component. This result is in agreement with the constitutive expression of the IL-2Rgamma gene and suggests a specific regulatory mechanism for IL-2Rgamma membrane translocation.

Anticoagulants↗

PubMed1998

The effect of combined epidural and light general anesthesia on stress hormones in open heart surgery patients.

This study was designed to evaluate the potential advantages of combined epidural and light general anesthesia over the commonly employed general anesthesia during open heart surgery. Twenty-four patients undergoing mitral valve replacement were thus studied. General anesthesia was maintained with an isoflurane-nitrous oxide-oxygen was mixture and morphine sulfate (0.4 mg/kg i.v. initially) followed by postoperative pain control with morphine in 12 patients (group GA). The remaining 12 patients (group EAA) received continuous epidural bupivacaine (0.125%)-morphine (50 micrograms/ml) supplemented with the same gas mixture as group GA. Epidural infusion was continued until the third postoperative day. Changes in the serum cortisol and beta-endorphin levels together with postoperative pain relief defined as good (scale 0-2), fair (3-4), or poor (5-10) were observed serially. Lower cortisol levels were observed in group EAA than in group GA (P < 0.05) just before skin closure, on the second and the third postoperative day. The beta-endorphin levels were substantially lower in group EAA than in group GA throughout the observation. The pain scores were good in 2 patients (17%), fair in 6 (50%), and poor in 4 (33%) for group GA, and good in 8 (67%), fair in 3 (25%), and poor in 1 (8%) for group EAA. We thus conclude that a combined epidural and light general anesthesia is considered to attenuate the stress response and thereby provides a better quality of postoperative pain control.

Adult↗

PubMed1998

Sialographic characterization of the normal parotid gland of the miniature pig.

OBJECTIVE: To characterize the structure of the parotid gland of the miniature pigs (minipig). METHODS: Sialographic, anatomical, histological and ultrastructural studies of the parotid gland were performed on 11 minipigs. RESULTS: Sialograms showed a long main duct and a triangular shaped gland. All branching ducts extended from the inferior-posterior margin of the main duct. No accessory glands were found. Typical serous acini were found microscopically and histochemically. CONCLUSION: This study provides basic structural information on the parotid gland of the minipig.

Animals↗

PubMed1998

Expression of Th1/Th2 cytokine mRNA in peritoneal exudative polymorphonuclear neutrophils and their effects on mononuclear cell Th1/Th2 cytokine production in MRL-lpr/lpr mice.

Peritoneal exudative polymorphonuclear neutrophils (PEC-PMN) and mononuclear cells (PEC-MNC) were obtained from normal BALB/c and from autoimmune MRL-lpr/lpr mice (lpr) with different disease severities. The spontaneous and mitogen-stimulated expression of T-helper lymphocyte type-1 (Th1) [represented by interferon-gamma (IFN-gamma) and interleukin (IL-2)] and T-helper lymphocyte type-2 (Th2) (represented by IL-4 and IL-10) cytokine mRNA in these cells was detected by reverse transcription-polymerase chain reaction (RT-PCR). The production of these cytokines was measured by enzyme-linked immunosorbent assay (ELISA). We found that the spontaneous expression of Th1/Th2 cytokine mRNA in PEC-PMN from autoimmune mice was progressively increased in parallel with disease severity but was not changed by lipopolysaccharide (LPS) stimulation. By contrast, spontaneous expression of Th1/Th2 cytokine mRNA in PEC-MNC from these mice was progressively decreased in parallel with disease severity but retained the responsiveness to phytohaemagglutinin (PHA) stimulation. To determine the effect of PEC-PMN on Th1/Th2 cytokine production by PEC-MNC, autologous PEC-PMN and PEC-MNC were co-cultured at MNC:PMN ratios of 5:0, 4:1, 3:2, 2:3, 1:4 and 0:5 with PHA stimulation for 24 hr. The production of cytokines at each ratio was compared with the expected value, by calculation. We found that PEC-PMN from autoimmune mice progressively suppressed the production of IL-4, IL-10 and IFN-gamma whereas the production of IL-2 was enhanced by autologous MNC in parallel with disease severity. These results suggest that a reciprocal relationship exists in the expression of Th1/Th2 cytokine mRNA between PEC-PMN and PEC-MNC in lpr mice in parallel with disease severity. Autoimmune PEC-PMN can exert significant modulatory effects on Th1/Th2 cytokine production by autologous MNC in stimulation.

Animals↗