Search PubMed⌕ Search

Biomedical subjects

K Seto

Publications and source records attributed to K Seto.

At least 37 records · Page 2Linked to original sources
PubMed1992

[Epidural midazolam with saline--optimal dose for postoperative pain].

Optimal dose of epidural midazolam with saline for postoperative pain relief was investigated. Forty three patients for upper abdominal surgery were divided into 5 groups. Each group had either 10 ml saline only (saline group), 10 ml saline + midazolam 0.025 mg.kg-1 (0.025 group), 10 ml saline + midazolam 0.05 mg.kg-1 (0.05 group), 10 ml saline + midazolam 0.075 mg.kg-1 (0.075 group), or 10 ml saline + midazolam 0.1 mg.kg-1 (0.1 group) administered epidurally for complaint of postoperative pain. Blood pressure (BP), heart rate (HR), respiratory rate (RR) and sedation score (SS) were monitored for 120 minutes, and the time interval for next analgesics (TNA) was checked. In each group, BP was unchanged compared with preinjection level. HR changes were less in 0.05 and 0.1 group than in others. RR changes were less in 0.025 and 0.05 group than in others. Optimal SSs were obtained in 0.025 and 0.05 groups. In 0.075 and 0.1 groups, many patients fell into complete sleep (not responded to verbal command). TNA was about 2 hours in 0.025 and 0.05 groups, over 6 hours in 0.075 and 0.1 groups. Complete sleep was the cause of long TNA in 0.075 and 0.1 groups. It was concluded that optimal dose of epidural midazolam with saline 10 ml was 0.05 mg.kg-1 for postoperative pain relief after upper abdominal surgery.

Abdomen↗
PubMed1992

[Surgical stress stimulates release of polymorphonuclear leukocyte elastase from a segmented neutrophil].

The studies were performed to find out whether increased serum levels of polymorphonuclear leukocyte elastase (PMNE) depend on increase of segmented neutrophils or increase of PMNE release from a segmented neutrophil on 17 patients for various elective surgeries. Serum levels of PMNE, leukocyte count and leukogram were determined before incision (preoperation), as well as on the 1st, 3rd and 5th day after operation. Serum levels of PMNE, segmented cell count, stab cell count, stab cell-segmented cell ratio increased most on the 1st postoperative day and decreased thereafter. Leukocyte count showed no significant changes. Serum levels of PMNE correlated well with PMNE released from a segmented neutrophil, but not with leukocyte count or segmented cell count. It was concluded that increased serum levels of PMNE by surgical stress depend on the increased PMNE release from a segmented neutrophil but not on the increased segmented cell count.

Adult↗
PubMed1991

The effect of incomplete bile duct obstruction on diisopropanolnitrosamine-induced cholangiocarcinoma.

This study was carried out to clarify the influence of incomplete bile duct obstruction (IBDO) on the occurrence and proliferation of cholangiocarcinoma and to evaluate the effect of release of IBDO at an early stage, using 175 Syrian golden hamsters. These hamsters received 500 mg/kg body weight of diisopropanolnitrosamine (DIPN) once weekly for 10 weeks, and then were divided into 3 groups, consisting of the simple laparotomy group (SL group), the IBDO group and 2 week IBDO group, in which IBDO was released after 2 weeks. The occurrence rates of cholangiocarcinoma at 20 weeks were 42% in the SL group, 76% in the IBDO group and 30% in the 2 week IBDO group. The mean numbers of tumors per hamster in the IBDO group were significantly greater than those in other groups (p less than 0.05). Both occurrence rates and numbers of tumors in the 2 week IBDO group were similar to those in the SL group. The proliferation of bile ductules and isolation of bacteria from bile in the IBDO group had higher rates at 15, 20 weeks than those found in the other groups. These results suggest that IBDO has an influence, as promoter, on the occurrence of cholangiocarcinoma induced by DIPN, and the disappearance of its promoting effect is caused by release of the obstruction.

Adenoma, Bile Duct↗
PubMed1991

[Epidural administration of midazolam with saline or bupivacaine for postoperative pain].

Postoperative pain relief and sedation with epidural midazolam-saline or midazolam-bupivacaine were studied in 46 patients after elective upper abdominal surgery. They were divided into 6 groups. In each group, 10 ml saline, 10 ml saline+midazolam 0.05 mg.kg-1, 10 ml saline+midazolam 0.1 mg.kg-1 (saline group), 0.25% bupivacaine 6 ml, 0.25% bupivacaine 6 ml + midazolam 0.05 mg.kg-1 or 0.25% bupivacaine 6 ml + midazolam 0.1 mg.kg-1 (bupivacaine group) was administered via epidural catheter for complaint of pain. For 120 minutes after epidural injection, blood pressure (BP), heart rate (HR), respiratory rate (RR), sedation score, and serum concentration of midazolam (conc midazolam) were evaluated. The time interval until next complaint of pain (pain relief time) was measured. In midazolam injected group, BP, HR, RR were not changed from preinjection value, but sufficient sedation was obtained and pain relief time was significantly prolonged compared with saline or bupivacaine injected group. Midazolam level was lower than that of sedation level. There were no significant differences between saline group and bupivacaine group, but the pain relief effect was slightly stronger in bupivacaine group. It is concluded that epidural saline - midazolam or 0.25% bupivacaine - midazolam is useful for postoperative pain relief after upper abdominal surgery.

Abdomen↗
PubMed1991

[Epidural midazolam for treatment of postoperative pain].

Postoperative pain relief and sedation with epidural midazolam were studied. Twenty-one patients for elective upper abdominal surgery were divided into 3 groups. Epidural catheter was inserted into thoracic epidural space before induction of general anesthesia. In each group, either 10 ml saline only, midazolam 0.05 mg.kg-1 + 10 ml saline, or midazolam 0.1 mg.kg-1 + 10 ml saline was injected into epidural catheter for complaint of pain in recovery room. For 120 minutes after epidural injection, blood pressure, heart rate, respiratory rate, serum concentration of midazolam, and sedation score were monitored. In midazolam injected groups, only slight changes were seen in blood pressure, heart rate, and respiratory rate. Sedation score was graded from 1 to 6:1 means complete sleep, and not responded to verbal command, 6 means agitated and many complaints. Midazolam 0.1 mg.kg-1 + 10 ml saline group had the lowest score, and saline 10 ml group had the highest score. Prolonged sedation and pain relief were obtained in midazolam injected group, especially 0.1 mg.kg-1 + 10 ml saline group. Serum midazolam concentrations were lower than 200 ng.ml-1. These values were considered as the lower limit for sedation by intravenous administration. In conclusion, epidural midazolam was useful for postoperative pain relief. The mechanism is considered to involve spinally mediated CNS action or direct spinal action.

Adult↗
PubMed1990

GABAergic mechanisms are involved in the control of tuberoinfundibular arcuate neurons by the accessory olfactory bulb.

In this study we examined electrophysiologically the involvement of the intrinsic GABAergic system of the accessory olfactory bulb (AOB) in controlling the activity of tuberoinfundibular (TI) arcuate neurons in anaesthetized female mice. Local infusions of the gamma-aminobutyric acid-A (GABAA) receptor antagonist, bicuculline into the AOB enhanced the spontaneous firing activity of TI arcuate neurons with excitatory inputs from the AOB. This finding reveals a neural mechanism responsible for the pregnancy blocking effect of this drug in freely behaving female mice and, taken together with the cytoarchitecture of the AOB, suggests that the reciprocal dendrodendritic interaction between mitral cells and GABAergic granule cells in the AOB is critical to control of AOB output to TI arcuate neurons as part of the final common pathway of the accessory olfactory system.

Animals↗
PubMed1990

Two pyridine analogues with more effective ability to reverse multidrug resistance and with lower calcium channel blocking activity than their dihydropyridine counterparts.

Four pyridine analogues and their dihydropyridine counterparts were examined for their ability to reverse drug resistance in a multidrug-resistant human carcinoma cell line, KB-C2. Two pyridine analogues were more able to reverse drug resistance than their dihydropyridine counterparts. The other two pyridine analogues had an effect on drug resistance similar to their dihydropyridine counterparts. The calcium channel-blocking activity of all the pyridine analogues was considerably lower than that of the dihydropyridine analogues. Of the pyridine analogues, 2-[4-(diphenylmethyl)-1-piperazinyl]ethyl 5-(trans-4,6-dimethyl-1,3,2-dioxaphosphorinan-2-yl)-2,6-dimethyl-4 -(3- nitrophenyl)-3-pyridinecarboxylate P-oxide (PAK-104P) was the most effective in reversing multidrug resistance. PAK-104P (1 and 5 microM) completely reversed the drug resistance in KB-8-5 and KB-C2 cells, respectively. The reversing effect of PAK-104P was greater than that of other multidrug resistance-reversing agents, cepharanthine, verapamil, nimodipine, and nicardipine. PAK-104P at 1 microM increased about 10-fold the accumulation of vinblastine in KB-C2 cells, whereas verapamil at the same concentration increased the accumulation about 2-fold. The inhibition of [3H]azidopine photolabeling of P-glycoprotein by the pyridine and dihydropyridine analogues except 2-[methyl(phenyl-methyl)amino]ethyl 4-(2-chlorophenyl)-5-(4-methyl-1,3,2-dioxaphosphorinan-2-yl)-1,4-d ihydro-2,6- dimethyl-3-pyridinecarboxylate P-oxide correlated with the reversing of drug resistance by the analogues. Some newly synthesized pyridine analogues seemed to have lower calcium channel-blocking activity and more potent resistance-reversing ability than verapamil and other calcium channel blockers.

ATP Binding Cassette Transporter, Subfamily B, Mem↗
PubMed1990

Neural mechanisms underlying the action of primer pheromones in mice.

Our electrophysiological experiments in female mice have provided evidence that electrical stimulation of the accessory olfactory bulb orthodromically excites a subpopulation of tuberoinfundibular arcuate neurons by way of the amygdala. The present study shows that half of such neurons are identified as dopaminergic by examining the effectiveness of infusing 6-hydroxydopamine and 5,7-dihydroxytryptamine locally into the median eminence in blocking their antidromic response. Further attention is focused on excitatory amino acid receptors within the amygdala and the amygdaloid pathway that mediate the accessory bulb-induced excitation of tuberoinfundibular arcuate neurons. The excitatory transmission was reversibly blocked by intra-amygdala infusion (3 nmol) of the excitatory amino acid antagonists kynurenic acid, D,L-2-amino-5-phosphonovalerate, gamma-D-glutamylaminomethylsulphonate and D,L-2-amino-4-phosphonobutyrate. Intra-amygdala infusions (3 nmol) of N-methyl-D-aspartate and kainate markedly enhanced the firing activity of tuberoinfundibular arcuate neurons with excitatory inputs from the accessory bulb, whereas similar infusions of quisqualate were without effect Intra-stria terminalis infusions of the local anaesthetic lignocaine completely abolished the excitatory transmission in all the cells tested. Furthermore, tuberoinfundibular arcuate neurons stimulated from the accessory bulb were also orthodromically stimulated from the stria terminalis with a shorter latency. These studies demonstrate that the projections of the accessory olfactory bulb activate excitatory amino acid receptors within the amygdala and subsequently the stria terminalis route, thereby causing excitation of tuberoinfundibular dopaminergic arcuate neurons. This functional pathway can account for the reproductive effects so far described as a consequence of vomeronasal chemoreception.

Amino Acids↗
PubMed1990

Influence of electrical stimulation of the hypothalamus on ovarian steroidogenesis in hypophysectomized and adrenalectomized rats.

The effects of electrical stimulation of the lateral hypothalamic area (LHA), periventricular arcuate nucleus (ARC) and ventromedial hypothalamic nucleus (VMH) on the rates of 14C transfer from 14C-1 acetate into ovarian steroids in ovarian slices of hypophysectomized and adrenalectomized (H-A) rats were investigated. The 14C transfer rates into estrogen and 20 alpha-hydroxypregn-4-en-3-one (20 alpha-OH-P) were decreased by LHA stimulation. The stimulation of the ARC and VMH increased the rates of 14C transfer into estrogen, progesterone and 20 alpha-OH-P. From these results, it might be suggested that these hypothalamic structures were involved in the regulation of ovarian steroidogenesis without participation of the pituitary and adrenal.

20-alpha-Dihydroprogesterone↗
PubMed1990

Influence of dorsal hippocampal stimulation and dorsal fornix lesions on hepatic glucose metabolism in rabbits.

We examined the effects of stimulation of the dorsal hippocampus and lesions of the dorsal fornix on glucose metabolism in liver slices of rabbits. Hippocampal stimulation decreased the 14C transfer rates from 14C-glucose into CO2, ketone bodies, cholesterol ester and free fatty acids, but increased the rates into triglyceride, phospholipids and glycogen. Fornix lesions had various effects on glucose metabolism, and the effects of hippocampal stimulation on glucose metabolism were abolished by fornix lesions. These observations support the hypothesis that the hippocampus is an integral part of the brain regulator system in the hepatic glucose metabolism.

Animals↗
PubMed1990

Influence of microinjection of insulin into the ventromedial hypothalamus on acetate metabolism in rumen epithelium of sheep.

Injections of 50 microU insulin into the ventromedial hypothalamic nuclei (VMH) in intact sheep decreased the rates of 14C transfer from 14C-1-acetate into CO2, glucose, ketone bodies, and increased the rates into triglyceride and phospholipids in rumen epithelium of sheep. Insulin injections into the parietal cortex of intact sheep or into the VMH of sheep with VMH lesions had no effect on the acetate metabolism in rumen epithelium as compared with the control groups which received saline injections into the same brain regions. These results support the view that the VMH serves as an integral part of an insulin-sensitive brain regulatory system in the acetate metabolism of rumen epithelium.

Acetates↗
PubMed1990

Ammonia production as a virulence expression by Mycoplasma salivarium.

Rabbits were inoculated intracutaneously with M. salivarium (ATCC 23064) cells. The size of the resulting swelling was significantly larger in 1) the sites inoculated with viable cells (7.5 x 10(9) CFU) suspended in a medium with arginine (arginine medium) than in those inoculated with killed cells, and in 2) those inoculated with cells suspended in arginine medium than with cells suspended in arginine-free medium. The swelling was enhanced when rabbits had previously been immunized with the organism. This effect was concluded to be due to ammonia which the organism produced by the hydrolysis of arginine through the arginine-dihydrolase pathway.

Ammonia↗
PubMed1990

[Detection of toxigenic Vibrio cholerae O1 using polymerase chain reaction for amplifying the cholera enterotoxin gene].

A rapid and simple procedure using polymerase chain reaction (PCR) was developed for the detection of cholera enterotoxin (CT) producing character. This method is based on amplifying a 380 base pair (bp) segment of the CT gene (ctx) which controls the production of CT. Two single-stranded oligonucleotides, synthetized to be complementary to the known nucleotide sequences of genes encoding the A-subunit of ctx, were used as extension primers. The oligonucleotide sequences are 5'TCAAACTATATTGTCTGGTC (CT-1) and 5'CGCAAGTATTACTCATCGA (CT-2). As template DNA was used 5 microliter of boiled bacterial culture broth at 95 degrees C for 5 min without the need for DNA extraction. The amplified target DNA were confirmed with only CT producing Vibrio cholerae O1 but not with CT non-producing organisms such as heat labile enterotoxin producing Escherichia coli by electrophoretic analysis of PCR mixture after amplification. A few isolates of CT producing V. mimicus and V. cholerae non-O1 were identified.

Enterotoxins↗
PubMed1990

[Development and testing of cholera enterotoxin gene probe for detection of toxigenic Vibrio cholerae O1].

A DNA probe was developed for the genetic detection from cholera enterotoxin (CT) producing Vibrio cholerae O1 and other organisms. The structural genes of CT (ctx) were cloned from chromosomal DNA of CT producing V. cholerae O1 569B. We subcloned a 552-base-pair fragment encoding a part of CT A-subunit for use of the CT-probe, and made the recombinant plasmid called pSKM24 which has eight copies of the CT-probe. The 32P-labeled CT-probe detected ctx in 72 isolates such as V. cholerae O1, V. cholerae non-O1 and other species of bacteria, but did not react heat-labile enterotoxin genes in enterotoxigenic Escherichia coli (ETEC) by DNA hybridization. The colony hybridization test using the CT-probe is specific, rapid and useful technique for detection of ctx and identification of CT producing V. cholerae.

DNA Probes↗
PubMed1990

Sleep apneas and cardiac arrhythmias in freely moving rats.

We studied the mechanisms of occurrences of apneas and bradyarrhythmias during sleep in five Wistar-Kyoto rats. We recorded electroencephalograms, electrocardiograms, chest wall movement, and diaphragmatic electromyograms (EMGdi) for three continuous days in each freely moving rat and demonstrated that: 1) 99% of the apneas and 99% of the bradyarrhythmias occurred during paradoxical sleep (PS), 2) 98% of the apneas were due to spontaneous cessations of respiratory drive, 3) the percentages among apneas accompanied with bradyarrhythmias were only about 30% and independent of the apneic durations, 4) every autoregressive power spectrum contained two significant components in the ranges of 50-80 and 110-140 Hz, which would be analogous to high-frequency oscillations postulated to originate in the synaptic input to the phrenic motoneurons from respiratory centers, and 5) spectral patterns of EMGdi signals varied with sleep states. These results suggest that "PS-related" neural activity modulating central respiratory output is important in inducing apneas and promoting bradyarrhythmias.

Animals↗
PubMed1990

Influence of incomplete bile duct obstruction on the occurrence of cholangiocarcinoma induced by diisopropanolnitrosamine in hamsters.

This study was performed to clarify the influence of incomplete bile duct obstruction (IBDO) on the occurrence of cholangiocarcinoma, using Syrian golden hamsters. These hamsters underwent simple laparotomy (SL) or IBDO at the choledochus and received diisopropanolnitrosamine (DIPN) once weekly for 20 weeks (SL-DIPN or IBDO-DIPN groups). Histological examination in the liver showed increased bile ductules, goblet cell metaplasia of the bile duct epithelium and cholangiocarcinoma in the two groups. The occurrence rates of cholangiocarcinoma at 20 weeks were 35% in the SL-DIPN group and 89% in the IBDO-DIPN group (p less than 0.01). The mean numbers of tumors per hamster in the IBDO-DIPN group were significantly higher than those in the SL-DIPN group (p less than 0.01). Regarding the composition of bile acid in the intraductal bile, both groups revealed an increase in primary bile acid, consisting of more than 80% of cholic acid. Bacteria were detected in the group with IBDO throughout the whole course. These results suggest that IBDO has an influence as promoter on the occurrence of DIPN-induced cholangiocarcinoma.

Adenoma, Bile Duct↗
PubMed1990

[Detection of two Shiga-like toxins from Escherichia coli O157:H7 isolates by the polymerase chain reaction method].

Fourteen isolates of E. coli O157:H7 and five isolates of S. dysenteriae type-1 were examined by polymerase chain reaction (PCR) for the structural genes (slt-I or slt-II), encoding Shiga-like toxins (SLTs). The two primer pairs (V1; 5'AGTTAATGTGGTGGCGAA and V2; 5'GACTGCGTCAGTGAGGTT for SLT-I, V3; 5'TTCGGTATCCTATTCCCG and V4; 5'TCTCTGGTCATTGTATTA for SLT-II) used were of the same positions representing the DNA sequence covering 471bp of the slt-I or slt-II. A 5-microliter portion of boiled bacterial culture broth was used as template DNA in a PCR-reaction mixture of 50 microliters. Two classes, slt-I alone or both slt-I and slt-II, were recognized in E. coli strains. All of S. dysenteriae type-1 strains examined contained slt-I alone. Our results indicate that PCR using these primer pairs is a simple, rapid, sensitive, and specific method and suitable for use in routine diagnostic microbiology laboratories.

Bacterial Toxins↗