Search PubMed⌕ Search

Biomedical subjects

K Randerath

Publications and source records attributed to K Randerath.

At least 163 records · Page 9Linked to original sources

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp.

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.

Animals↗

32P-labeling test for DNA damage.

Covalent adducts formed by the reaction of DNA with chemical carcinogens and mutagens may be detected by a 32P-labeling test. DNA preparations exposed to chemicals known to bind covalently to DNA [N-methyl-N-nitrosourea, dimethyl sulfate, formaldehyde, beta-propiolactone, propylene oxide, streptozotocin, nitrogen mustard, and 1,3-bis(2-chloroethyl)-1-nitrosourea] were digested to a mixture of deoxynucleoside 3'-monophosphates by incubation with micrococcal endonuclease (EC 3.1.31.1) and spleen exonuclease (EC 3.1.16.1). The digests were treated with [gamma-32P]ATP and T4 polynucleotide kinase (ATP:5'-dephosphopolynucleotide 5'-phosphotransferase, EC 2.7.1.78) to convert the monophosphates to 5'-32P-labeled deoxynucleoside 3',5'-bis-phosphates. These compounds were then separated on polyethyleneimine-cellulose thin layers in ammonium formate and ammonium sulfate solutions. Autoradiograms of the chromatograms obtained by this high-resolution procedure showed the presence of nucleotides derived from chemically altered, as well as normal, DNA constituents. Maps from DNA exposed to any of the chemicals used exhibited a spot pattern typical for the particular chemical. This method detected a single adduct in 10(5) DNA nucleotides without requiring that the compound under investigation be radioactive and thus provides a useful test to screen chemicals for their capacity to damage DNA by covalent binding.

Animals↗

Lack of a specific ribose methylation at guanosine 17 in Morris hepatoma 5123D tRNASer1IGA.

Tumor transfer RNA's (tRNA's) frequently exhibit alterations in column chromatographic profiles and in base compositions when compared to their normal counterparts. Because such alterations may be involved in the dedifferentiated state of cancer cells, it is of interest to determine their structural basis and functional significance. The recent development of highly sensitive postlabeling methods has now made possible sequence analysis of tRNA's from neoplastic tissues available only in limited amounts. We have determined the nucleotide sequence of Morris hepatoma serine tRNA (anticodon IGA) and compared it with its normal counterpart in rat liver. The tumor serine tRNA was found to lack the ribose methylation of guanosine in position 17 of the dihydrouridine loop present in the liver RNA. This result explains the column chromatographic shifts of Morris hepatoma 5123D seryl-tRNA isoacceptors, suggesting that all seryl-tRNA isoacceptors may lack this modification.

Animals↗

Isolation and sequence analysis of two major leucine transfer ribonucleic acids (anticodon Mm-A-A) from a rat tumor, Morris hepatoma 5123D.

The nucleotide sequences of two major tRNALeu species (anticodon Mn-A-A)isolated from Morris hepatoma 5123D were determined by a combination of a newly developed thin-layer readout sequencing method [Gupta, R. C., & Randerath, K. (1979) Nucleic Acids Res. 6, 3443-3458] and additional 3H- and 32P-labeled derivative methods entailing chromatographic fingerprinting and base-specific enzymatic cleavages. The nucleotide sequence of the two hepatoma tRNAMm-A-ALeu species, one of which has U and the other of which has A in position 50 at the tip of the long extra arm, is pG-U-C-A-G-m2G-A-U-G-(m2)G-C-(ac4)C-G-A-G-U-G-G-D-C-psi-A-A-G-G-C-m22G-C-C-A-G-A--C-U-Mm-A-A-m1G*-psi-psi-C-U-G-G-L-(psi)U-C-C-G-U- or A-A-U-G-G-A-G-m5C-G-U-G-G-G-T-psi-C-G-m1A-A-U-C-C-C-A-C-U-U-C-U-G-A-C-A-C-C-AOH. These are the first leucine tRNA sequences from higher eukaryotes that have been determined. Noteworthy features of the mammalian leucine tRNAs are the presence of psi in the beta region of the D loop and the occurrence of three unknown hypermodified nucleosides (Mm, m1G*, and L) in positions 35, 38, and 45, respectively. m1G* was converted to m1G by treatment with alkali. Sequencing gels indicated that the parent base of the 2'-O-methylated nucleoside Mm may be a pyrimidine, probably a C derivative, as indicated by the chromatographic behavior of nucleotides containing Mm. The presence of a pyrimidine in the wobble position would be consistent with the antidodon sequence Mm-A-A and the leucine condons U-U-G and U-U-A. The occurrence of a hypermodified nucleoside, L, in the first position of the long extra arm appears unusual; thus far the only modified nucleoside found in this position is Um in eukaryotic serine tRNAs. Since all tRNAs with a long extra arm sequenced to date have a pyrimidine in this position, L is likely to be a pyrimidine, probably a U derivative, as inferred from chromatographic data.

Animals↗

Mechanism of 5-azacytidine-induced transfer RNA cytosine-5-methyltransferase deficiency.

The administration of 5-azacytidine to mice leads to a specific, rapid, time-dependent, and dose-dependent decrease of transfer RNA (tRNA) cytosine-5-methyltransferase activity of mouse liver and the synthesis of tRNA specifically lacking 5-methylcytidine. The mechanism of this enzyme deficiency was investigated. The pretreatment of mice with RNA synthesis inhibitors such as actinomycin D and D-galactosamine prevented the enzyme deficiency induced by 5-azacytidine administration. These results suggested that RNA synthesis was a prerequisite for the induction by 5-azacytidine of the enzyme inhibition in vivo. Indeed, a slowly sedimenting RNA (4 to 7S) from the livers of mice treated with 5-azacytidine, when present in an in vitro tRNA methyltransferase assay, decreased specifically the activity of tRNA cytosine-5-methyltransferase. The pretreatment of mice with actinomycin D or D-galactosamine prior to the administration of 5-azacytidine effectively prevented the formation of such inhibitory RNA in vivo as determined by an in vitro tRNA methyltransferase assay. These results indicate that the administration of 5-azacytidine to mice leads to the rapid synthesis of a low-molecular-weight RNA fraction which is capable of specifically inactivating tRNA cytosine-5-methyltransferase activity in vivo and in vitro.

Animals↗

Ribosome binding site analysis of ovalbumin messenger ribonucleic acid.

The region of the ovalbumin messenger ribonucleic acid (mRNAov) molecule bound to the 40S ribosomal subunit and its associated initiation factors in the wheat germ cell-free translation system were isolated and characterized. Two mRNAov fragments, 87 and 92 nucleotides in length, were protected from T1 ribonuclease digestion by binding of guanosine 5',beta,gamma-methylenetriphosphate and were shown by hybridization and fingerprint mapping to be derived from the 5' end of mRNAov. Both these mRNAov fragments were of sufficient length to contain both the cap structure and the AUG initiation codon. Four T1-resistant oligonucleotides, prepared by direct digestion of mRNAov with T1 ribonuclease were also found to bind to the wheat germ 40S ribosomal subunit. Nucleotide sequence analysis of these oligonucleotides revealed (1) that they were not a subset of the ribosome binding fragments described above, (2) that they were derived from within the mRNAov molecule (one from within the coding region and three from the noncoding region at the 3' end of the mRNAov molecule), and (3) that three of the four mRNAov nucleotides contained 3'-terminal AUG trinucleotides. These data suggested that features of the mRNAov molecule in addition to the nucleotide sequence might be important in specifying the correct ribosome binding site for the initiation of protein synthesis. The amount of mRNAov bound to the wheat germ 40S ribosomal subunit in a preinitiation complex was found to vary inversely with the potassium ion concentration. Lowering the potassium concentration to levels suboptimal for translation also resulted in the protection of larger fragments of the mRNAov molecule derived from the same 5'-end region as the ribosome binding fragments described above. The ability of the cap analogue 7-methylguanosine 5'-phosphate (m7G5'p) to reduce the amount of mRNAov bound to the wheat germ 40S ribosomal subunit was found to depend directly on thepotassium concentration. Interestingly, the effects of potassium on the amount of mRNAov bound in a preinitiation complex and the inhibition of this binding by m7G5'p could be observed by changing the potassium concentration after binding had occurred. These data suggested that the interaction between the wheat germ 40S ribosomal subunit and mRNAov was very sensitive to the ionic environment.

Animals↗

The nucleotide sequence of human tRNAGly (anticodon GCC).

The sequence of tRNAGCCGly from human placenta was determined by recently developed postlabeling techniques. The tRNA was digested completely with RNases T1 and A in the presence of alkaline phosphatase, the oligonucleotides were 3'-terminally (3H)-labeled, mapped on PEI-cellulose thin layers, isolated, and sequenced by methods based on base-specific cleavages. Overlaps were obtained by readout sequencing techniques on polyacrylamide gels and PEI-cellulose thin layers. The thin-layer readout technique was used also to locate and identify modified nucleotides. The primary structure was found to exhibit a large degree of homology (94.6%) with silkworm tRNAGCCGly but only 67.6% homology with human tRNACCCGly.

Anticodon↗

Rapid print-readout technique for sequencing of RNA's containing modified nucleotides.

A rapid, simple, and highly sensitive method for sequence analysis of RNA was developed, which consists of the following steps: (i) controlled hydrolysis of the RNA by brief heating in water; (ii) (32P)-labeling of 5'-hydroxyl groups of the fragments produced in (i); (iii) resolution of labeled fragments by size on polyacrylamide gels giving the familiar "ladder"; (iv) contact transfer ("print") of the ladder from the gel to a PEI-cellulose thin layer; (v) in situ treatment of the ladder with RNase T2 resulting in the release of 5'-(32P)-labeled nucleoside-3',5' diphosphates; (vi) contact transfer and thin-layer separation of (32P)-labeled nucleotides on PEI-cellulose in ammonium sulfate and ammonium formate solvents; (vii) autoradiography. The chromatographic behavior of the 4 major and 18 modified nucleotides was determined. The positions of major and modified nucleotides in the sequence can be read directly from the separation patterns displayed on X-ray film. As this is the only sequencing method presently available that allows one to display and identify directly the positions in the RNA chain of major and modified nucleotides, no additional procedures are required to analyze the latter.

Base Sequence↗

Yeast tRNA Leu UAG. Purification, properties and determination of the nucleotide sequence by radioactive derivative methods.

A second major species of leucine tRNA, tRNA Leu UAG (formerly designated tRNA Leu CUA) was purified from baker's yeast in a three-step procedure entailing BD-cellulose chromatography in the presence and absence of Mg2+ and Sephadex G-100 gel filtration. Results of aminoacylation and partial RNase T1 digestion experiments showed that this tRNA retains a native conformation under conditions that denature yeast tRNA Leu m5CAA (tRNA3 Leu). The primary structure of baker's yeast tRNA Leu UAG was elucidated by application of sensitive radioactive isotope derivative ("postlabeling") methods. Complete RNase T1 and A and partial RNase U2 fragments, prepared from non-radioactive tRNA and 5'-half and 3'-half molecules, were separated by two-dimensional polyethyleneimine-cellulose anion-exchange thin-layer chromatography and isolated by a novel micropreparative procedure affording high yields of these compounds in sufficient purity for subsequent tritium derivative analysis. Base composition and sequence of oligonucleotides were analyzed by tritium derivative methods. Molar ratios of the fragments were determined from the radioactivity of 3H-labeled nucleoside trialcohols in combination with base analysis. 2'-O-Methylated guanosine was characterized using the [gamma-32P]ATP/polynucleotide kinase reaction. The analysis of classical complete and partial RNase digests by the tritium derivative methods yielded the complete nucleotide sequence of the tRNA. A total of about 20 A260 units of the RNA was used for analysis, i.e. considerably less material than required for conventional spectrophotometric analysis. A different sequencing approach, consisting of a combination of "readout sequencing" with tritium sequencing of complete RNase T1 and A fragments, was applied to the 3'-half molecule. The 3'-half molecule was labeled with 32P at its 5' terminus, partially degraded with RNase T1, U2, and Phy1 and with alkali, and subjected to polyacrylamide gel electrophoresis. The sequence was read off the gel on the basis of cleavage patterns and size of the fragments. While the readout procedure provided only the positions of A, U, C, and G residues in the chain, additional information from tritium derivative analysis was utilized to define the positions of the modified nucleosides. The readout sequencing procedure was found to require less than 0.01 A260 unit of RNA and the analysis of the complete fragments about 6 A260 units. Interesting structural features of tRNA Leu UAG are (a) the location of unique, leucine tRNA iso-acceptor-specific sequences next to U-8, a constant nucleotide participating in synthetase recognition, (b) the occurrence of 1-methyladenosine in the T loop, a modification not present in the structurally related tRNA Leu m5CAA, and (c) the unusual presence of an unmodified uridine in the first position of the anticodon, which may be related to the unusual coding properties reported for this tRNA.

Adenine↗

Aminoacylation of undermethylated mammalian transfer RNA.

To study the role of 5-methylcytidine in the aminoacylation of mammalian tRNA, bulk tRNA specifically deficient in 5-methylcytidine was isolated from the livers of mice treated with 5-azacytidine (18 mg/kg) for 4 days. For comparison, more extensively altered tRNA was isolated from the livers of mice treated with DL-ethionine (100 mg/kg) plus adenine (48 mg/kg) for 3 days. The amino acid acceptor capacity of these tRNAs was determined by measuring the incorporation of one of eight different 14C-labeled amino acids or a mixture of 14C-labeled amino acids in homologous assays using a crude synthetase preparation isolated from untreated mice. The 5-methylcytidine-deficient tRNA incorporated each amino acid to the same extent as fully methylated tRNA. The tRNA from DL-ethionine-treated livers showed an overall decreased amino-acylation capacity for all amino acids tested. The 5-methylcytidine-deficient tRNA from DL-ethionine-treated mice were further characterized as substrates in homologous rate assays designed to determine the Km and V of the aminoacylation reaction using four individual 14C-labeled amino acids and a mixture of 14C-labeled amino acids. The Km and V of the reactions for all amino acids tested using 5-methylcytidine-deficient tRNA as substrate were essentially the same as for fully methylated tRNA. However, the Km and V were increased when liver tRNA from mice treated with DL-ethionine plus adenine was used as substrate in the rate reaction with [14C]lysine as label. Our results suggest that although extensively altered tRNA is a poorer substrate than control tRNA in both extent and rate of aminoacylation, 5-methylcytidine in mammalian tRNA is not involved in the recognition of the tRNA by the synthetase as measured by aminoacylation activity.

Amino Acids↗

Base composition studies on transfer RNA from normal and regenerating rat liver.

The base composition of bulk tRNA isolated from regenerating rat liver, 12, 18, 24 and 30 h after partial hepatectomy, was determined by a 3H derivative method. Only a few minor statistically significant changes (2--11%), as compared to sham-operated liver, were found at 18, 24 and 30 h after hepatectomy. These included a reduction in the amounts of adenosine and 3-(3-amino-3-carboxypropyl)-uridine, and an increase in the amounts of 1-methyl-adenosine, 1-methylguanosine, 3-methylcytidine and pseudouridine. Similarly, when the base composition of tRNA fractions from control and 24-h regenerating rat liver, partially purified by one-dimensional polyacrylamide gel electrophoresis, was determined, no gross differences were observed. These results suggest that the process of liver regeneration is not accompanied by a gross alteration of the modification pattern of tRNA.

Animals↗