Biomedical subjects

K R Williams

Publications and source records attributed to K R Williams.

At least 37 records · Page 2Linked to original sources

PubMed1997

Investigation of the integration process of dental implants by means of a numerical analysis of dynamic response.

OBJECTIVES: The aim of this work was to present a preliminary numerical analysis of the integration process of dental implants using a finite element simulation of the dynamic response following impulse excitation. Assessment of the osseointegration process has been previously examined using a numerical approach by calculating the natural frequency of a cantilever attached to the implant. The methodology adopted in this work allows a direct measurement of the implant response following impulse loading and avoids the addition of a bulky cantilever set-up. METHODS: The geometric configuration was obtained by averaging the coordinate data from tomographic scans of 14 mandibles. The materials properties were approximated from experimental analysis performed on trabecular and cortical bone tissue. A load was applied to the top of the implant in one direction resulting in an initial displacement. The implant was then freed and allowed to vibrate over approximately 10 cycles. Three fixity conditions were assumed by changing the properties of the surrounding bone ranging from full integration to a poorly integrated implant typical of the situation during bone healing following surgery. The results of the three fixity conditions were compared by calculating the fundamental displacement amplitudes and frequencies of the vibrating impact. RESULTS: The calculated results indicated that the implant vibrated at a predominant frequency when partially integrated with a displacement principally in the direction of the applied impulse. However, when the implant was fully integrated a more complex vibration pattern ensued, suggesting the superposition of two or more fundamentals. SIGNIFICANCE: Attention has been paid to the formulation of the numerical model for validation purposes as well as a reliable reference for the optimum interpretation of the experimental data. In this way it was possible to establish a simulation procedure to investigate the response of the tissues surrounding the implant and their properties at different stages of healing. It should be pointed out that the numerical procedures represented a valid preliminary approach to the problem and were capable of indicating a guide to the optimum design of the experimental apparatus for measurement of displacement and frequency in vivo.

Alveolar Process↗

PubMed1997

Impulse response of a dental implant in bone by numerical analysis.

The osseointegration process of titanium dental implants in bone has been simulated previously using natural frequency and impulse excitation. However, the impulse strength was arbitrarily chosen and may not have yielded the correct frequencies and displacements to be compared with those measured in a clinical situation. In this work the range of impulse excitation strengths applied to a dental implant osseointegrated in bone and the corresponding response have been examined using the finite element method. Both conditions of a dental pin only and a dental pin with attached cantilever integrated in the mandible have been examined. The dynamic analysis indicated that the frequency and displacement responses are indeed sensitive to impulse duration and direction but independent of impulse load. The analysis summarizes the proper impulse excitation values for a correct interpretation of clinically measured frequency response data.

Biomechanical Phenomena↗

PubMed1997

Crystal structure of the two RNA binding domains of human hnRNP A1 at 1.75 A resolution.

Heterogeneous ribonucleoprotein A1 (hnRNP A1) is an abundant eukaryotic nuclear RNA binding protein. A1 is involved in the packaging of pre-mRNA into hnRNP particles, transport of poly A+ mRNA from the nucleus to the cytoplasm and may modulate splice site selection. The crystal structure of A1(RBD1,2) reveals two independently-folded RNA binding domains (RBDs) connected by a flexible linker. Both RBDs are structurally homologous to the U1A(RBD1), and have their RNA binding platforms oriented in an anti-parallel fashion. The anti-parallel arrangement of the A1 RNA binding platforms suggests mechanisms for RNA condensation and ways of bringing together distant RNA sequences for RNA metabolism such as splicing or transport.

Binding Sites↗

PubMed1997

Mode shapes of a damaged and repaired tympanic membrane as analysed by the finite element method.

This work makes use of recent finite element discretization of the human tympanic membrane where the known anisotropy of the tympanic membrane is implemented by a series of thin beam elements superimposed on thin shell membrane elements. These thin beam elements were introduced in order to simulate the fibre structure of the tympanic membrane. The onset of tympanosclerosis has been modelled as a gradual increase in tympanic membrane density and modulus in the affected area. This increased density results in a fall of 55% of the first natural frequency for only a 16% area of drum sclerosis. Additionally the amplitude response is significantly reduced. Repair of the membrane was simulated by removal of the fibre system from the affected area. Under these circumstances the natural frequencies virtually return to the healthy state but the mode shapes of vibration do not. The repair to the membrane, although not significantly altering frequency values, has resulted in a disruption to the normal mode shape patterns with consequences in the movements conveyed to the stapes and cochlear fluids.

Cochlea↗

PubMed1997

Selection on the protein-coding genes of the TBE1 family of transposable elements in the ciliates Oxytricha fallax and O. trifallax.

TBE1s are "cut-and-paste" transposable elements found in high copy number in the germline genomes of the ciliates Oxytricha fallax and O. trifallax. TBE1 "family" sequence (sequence of mixed polymerase chain reaction products generated using primers that match roughly half the TBE1s in host whole-cell DNA) was obtained from both host species. Although family sequence autoradiograms represent thousands of different elements, they are as legible as those representing corresponding sequences of a single TBE1, implying that ideal polymorphisms are rare within the genes examined. Nucleotide polymorphisms among TBE1s (indicated by ambiguities in family sequence) are far more common at third than at first or second positions of codons of genes, implying that selection has conserved the amino acid sequences of these genes in the majority of TBE1s. Portions of the transposase gene and another TBE1 gene have been sequenced from 10 individual TBE1s. None of these portions is interrupted by stop codons or frameshifts, and, for both genes, pairwise comparisons of these sequences show that nonsynonymous differences are significantly less common than synonymous differences, again implicating conservative selection Phylogenetic analysis shows that multiple divergent lineages of TBE1s have evolved under this selection within O. fallax. All these results are unexpected for cut-and-paste transposons in eukaryotic hosts: since transposase encoded by intact elements presumably acts in trans, it can duplicate mutant copies (those that do not encode functional transposase) found in the same genome, and thus no selection is expected to maintain the transposase gene. The selection demonstrated here could act at transposition (if functional TBE1s are preferentially transposed) or at the level of the host (if the host's fitness depends on functional TBE1 genes). TBE1-encoded proteins might be responsible for the precise excision of TBE1s that occurs during development of the host somatic nucleus; selection on hosts for uninterrupted somatic genes would then translate into selection for TBE1 protein-coding competence. We suggest a method for distinguishing between these two classes of explanations by finding and analyzing divergent alleles of ancestral transposable element insertions.

Animals↗

PubMed1997

Site-to-site variability of drug concentrations in skeletal muscle.

The homogeneity of drug concentrations in skeletal muscle was assessed in eight fatal overdoses. Ten to 30 random samples were taken from leg muscle weighing 1,650 to 7,985 g. For cases involving paracetamol the mean muscle-to-blood ratio ranged from 0.1 to 1.1 (n = 4) for amitriptyline 1.1 to 3.6 (n = 3), and for dothiepin 0.8 to 2.1 (n = 2). The coefficient of variance was large for all drugs, ranging from 10.5 (carbamazepine) to 50 (thioridazine). Skeletal muscle is not homogeneous with respect to drug concentrations in fatal overdose cases. Of 16 instances of drug detection in blood 2 (nortriptyline and promethazine) were not detected in muscle. Muscle-to-blood drug ratios varied significantly among cases, possibly influenced by survival time after drug ingestion. Quantitative interpretations of muscle drug levels present significant difficulties. However, skeletal muscle can be used for qualitative corroboration of blood analyses and is a suitable specimen for drug detection where none other is available.

Acetaminophen↗

PubMed1997

A dynamic and harmonic damped finite element analysis model of stapedotomy.

This study was undertaken in an attempt to better understand the mechanics of sound transmission at the footplate following stapedotomy. The insertion of a Teflon (polytetrafluoroethylene) stapes prosthesis introduces new constraints within the reconstructed ossicular chain which have an effect on the normal vibration patterns of the tympanic membrane. In a finite element model of the ear, constraints have been reproduced as a series of spring constants in the incus/prosthesis/footplate interfaces incorporating damping to simulate the impedance of the inner ear. At zero damping, the frequency response at the pseudo stapes footplate exhibit several maxima and minima between 800 Hz and 2.5 Hz. At higher damping values, these maxima and minima become smoothened out with two or three naturals occurring over the same frequency range. Severe ankylosis of a diseased footplate is reproduced by over-damped conditions. The umbo, incus and stapes footplate vibrate in phase with similar frequencies at light damping levels. The movement of the prosthesis at the pseudo-footplate can be large in the out of plane axis of the ossicular chain, unless sufficient support is provided at the reconstructed footplate. Clinically, this would suggest the vein graft interposed between the piston and stapedotomy hole should endow resistance and elasticity to the system.

Acoustics↗

PubMed1996

hnRNP A1 binds promiscuously to oligoribonucleotides: utilization of random and homo-oligonucleotides to discriminate sequence from base-specific binding.

To understand the range of possible and probable A1 functions in pre-mRNA biogenesis, it is important that we quantify the relative ability (or inability) of A1 to bind high affinity RNA target sequences and/or structures. Using a fluorescence competition assay we have determined apparent binding affinities for a wide range of 20mer oligos containing putative and possible A1 targets including the high affinity 'winner' sequence identified by selection/amplification [Burd,C.G and Dreyfuss,G. (1994) EMBO J. 13, 1197-1204], AUUUA sequences found in 3'-UTRs of labile mRNAs, 5'- and 3'-splice sites and telomeric sequences. With the exception of a 20mer 'winner' sequence, all other 20mers examined bind A1 with a narrow, approximately 10-fold range of affinities extending from 3.2 x 10(6) to 4.2 x 10(7) M(-1). Studies with homo-oligomers suggest this range reflects nucleotide base rather than sequence specificity and hence, it was possible to predict reasonably accurate affinities for all other 20mers examined except for the 'winner', whose unusually high affinity of 4.0 x 10(8) M(-1) results from a unique higher order structure and sequence. Since there is no known physiological role for the 'winner' 20mer sequence, these data suggest A1 generally binds indiscriminately to all available pre-mRNA sequences. Both the large abundance of A1 in vivo and its binding properties are thus consistent with it playing a structural role in pre-mRNA biogenesis.

Binding, Competitive↗

PubMed1996

Purification and characterization of a recombinant hepatitis E protein vaccine candidate by liquid chromatography-mass spectrometry.

A protein with a molecular mass of approximately 62.10(3), derived from open reading frame 2 (ORF-2) of the hepatitis E virus (HEV: Burma strain), was expressed in a baculovirus expression vector and purified to homogeneity. The recombinant 62 kDa protein appeared to be a doublet, as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Tryptic digestion in conjunction with laser desorption mass spectrometry (LD-MS) and sequence analysis of the tryptic peptides indicated that the amino terminus was blocked, although no proteolytic degradation occurred. The determined internal sequences of peptides were in agreement with the predicted ORF-2 protein. Reversed-phase liquid chromatography coupled to electrospray mass spectrometry (LC-MS) resolved the doublet proteins into two major components with molecular masses of 56548.5 and 58161.4. Confirmation of the amino terminus of the molecule by LD-MS post-ion decay enabled us to tentatively assign the carboxyl terminus of each species at residues 540 and 525. Sequencing of the intact protein by automated carboxyl terminal sequencing confirmed that the carboxyl terminus was truncated and that the sequence assignment predicted by LC-MS was correct.

Amino Acid Sequence↗

PubMed1996

Origins of binding specificity of the A1 heterogeneous nuclear ribonucleoprotein.

The A1 heterogeneous nuclear ribonucleoprotein (hnRNP) is the best studied of the "core" hnRNP proteins that are tightly associated with heterogeneous nuclear RNA (hnRNA) within eukaryotic nuclei. Previous studies suggested that hnRNP A1 preferentially binds (under nonequilibrium conditions) to the pyrimidine-rich span of sequence at the 3'splice site of most introns [Swanson, M.S., & Dreyfuss, G. (1988) EMBO J. 11, 3519-3529; Buvoli et al. (1990) Nucleic Acids Res. 18, 6595-6600; Ishikawa et al. (1993) Mol. Cell. Biol. 13, 4301-4310]. Recently, Burd and Dreyfuss [(1994) EMBO J. 13, 1197-1204] used selection/amplification from pools of random sequence RNA to uncover an even higher-affinity A1 oligo that contained two copies of a high-affinity consensus sequence, UAGGGU/A. We have extended these studies by using a fluorescence assay to characterize the equilibrium binding properties of A1 to each of these oligonucleotides. By also characterizing the binding of A1 to sequence-randomized control oligonucleotides, we have been able to better evaluate the inherent "sequence-specific" binding properties of A1. Although these studies indicate that under equilibrium conditions A1 cannot specifically recognize the beta-globin, 3'-splice site DNA oligo analogue studied by Buvoli et al. (1990), they confirmed the high-affinity binding to the "winner" 20-mer RNA that was uncovered via selection/amplification and that has the sequence UAUGAUAGGGACUUAGGGUG (Burd & Dreyfuss, 1994). In 0.1 M NaCl, we found that A1 has approximately 100-fold higher affinity for this winner sequence sequence than it does for either a randomized version of this sequence or a 20-mer oligo corresponding to an unrelated beta-globin intron sequence. This winner RNA oligo aggregates in solution to form an apparent dimer that may represent a G-quartet resulting from dimerization of two Hoogsteen base-paired hairpins. On the basis of salt sensitivity studies carried out with various fragments of A1, the ability of A1 to discriminate the winner sequence from its randomized control results primarily from increased ionic interactions with the glycine-rich, COOH terminal domain of A1 that extends from residue 196 to 319. Nonetheless, most of the overall energy of binding for the A1 winner complex results from determinants that are resident within the first 195 residues of A1. The unique ability of the winner sequence (but not its sequence-randomized control) to form a higher-order aggregate, which may correspond to a G-tetrad, appears to facilitate the additional ionic interactions with the COOH terminal domain. Taken together, these data suggest the need to reevaluate possible and probable functions of A1 in vivo.

Amino Acid Sequence↗

PubMed1996

"ADAM' or "EVE'?--a toxicological conundrum.

The 3,4-methylenedioxy ring-substituted amphetamines, including "ADAM' and "EVE', are currently popular drugs of abuse. Adverse reactions are reported in the clinical literature but few fatal cases are documented and little toxicological data is available to guide those determining the cause or manner of death in such cases. We report two deaths presenting in a similar manner and with similar clinical features. Various body fluid samples were analysed for amphetamines by gas chromatography/mass spectrometry. In one case, amphetamine alone was detected at levels of 1.54 mg/l and 1.47 mg/l in postmortem blood and admission serum, respectively. The other involved several 3,4-methylenedioxy ring-substituted amphetamines, namely MDA, MDMA and MDEA, at levels of 0.25 mg/l, 0.43 mg/l and 0.3 mg/l, respectively in postmortem femoral blood and 0.24 mg/l, 0.55 mg/l and 0.49 mg/l in admission blood. The interpretation of these toxicological results and some novel legal issues are discussed.

3,4-Methylenedioxyamphetamine↗

PubMed1996

Cyclical deformation behaviour of denture soft lining materials.

OBJECTIVES: The purpose of the study was to examine and describe the deformation behaviour of five denture soft lining materials under dynamic cyclic loading over a range of applied forces using apparatus designed to simulate masticatory performance. METHODS: Five lining materials were tested over 5-min periods using an Instron tensile testing machine that was modified to measure load and strain semi-continuously during cyclic loading. RESULTS: Strain energy and strain energy densities and moduli values for each material were calculated. The strain energy absorbed at separate times during the cycling period demonstrated the elastic behaviour of the materials over the 5-min simulated chewing cycle. CONCLUSIONS: All materials demonstrated elastic but not perfectly linearly elastic behaviour over the chosen loading and cycling frequency. Molloplast B absorbed most energy at the lower testing loads and Novus absorbed most energy at the higher loads.

Acrylic Resins↗

PubMed1996

Internal eliminated sequences interrupting the Oxytricha 81 locus: allelic divergence, conservation, conversions, and possible transposon origins.

Internal eliminated sequences (IESs) often interrupt ciliate genes in the silent germline nucleus but are exactly excised and eliminated from the developing somatic nucleus from which genes are then expressed. Some long IESs are transposons, supporting the hypothesis that short IESs are ancient transposon relics. In light of that hypothesis and to explore the evolutionary history of a collection of IESs, we have compared various alleles of a particular locus (the 81 locus) of the ciliated protozoa Oxytricha trifallax and O. fallax. Three short IESs that interrupt two genes of the locus are found in alleles from both species, and thus must be relatively ancient, consistent with the hypothesis that short IESs are transposon relics. In contrast, TBE1 transposon interruptions of the locus are allele-specific and probably the results of recent transpositions. These IESs (and the TBE1s) are precisely excised from the DNA of the developing somatic macronucleus. Each IES interrupts a highly conserved sequence. A few nucleotides at the ends of each IES are also conserved, suggesting that they interact critically with IES excision machinery. However, most IES nucleotide positions have evolved at high rates, showing little or no selective constraint for function. Nonetheless, the length of each IES has been maintained (+/- 3 bp). While one IES is approximately 33 bp long, three other IESs have very similar sizes, approximately 70 bp long. Two IESs are surrounded by direct repeats of the sequence TTCTT. No other sequence similarities were found between any of the four IESs. However, the ends of one IES do match the inverted terminal repeat consensus sequence of the "TA" IESs of Paramecium. Three O. trifallax alleles appear to have been recipients in recent conversion events that could have been provoked by double-strand breaks associated with IES ends subsequent to IES transposition. Our findings support the hypothesis that short IESs evolved from ancient transposons that have lost most of their sequences, except those necessary for precise excision during macronuclear development.

Alleles↗

PubMed1996

An experimental technique for determining middle ear impedance.

A two-microphone technique was used to determine the middle ear impedance of a live subject. The procedure involved the application of standing wave tube theory and the assumption that the ear canal behaves like an homogeneous cylinder with plane acoustic wave propagation up to a certain frequency--2 kHz for the current analysis. During experimentation the subject lay on a bench with his head braced against a wooden fixture. Acoustic pressures were recorded from the ear canal by the use of a spectrum analyser and probe microphones with flexible tips. Resultant impedance curves show middle ear natural frequencies at 831 Hz and 1,970 Hz with high levels of damping. The reactive impedance curves show the influence of stiffness and ossicular mass on middle ear sound transmission. An advantage of the approach is that using features of the recorded data it is possible to calculate the effective probe tip to eardrum distance required for the calculation of the middle ear impedance. The two-microphone technique appears to be a promising tool for assessing healthy and diseased middle ear function.

Acoustic Impedance Tests↗

PubMed1996

Influence of titanium oxide and titanium peroxy gel on the breakdown of hyaluronan by reactive oxygen species.

The molecular events occurring at the interface between titanium and connective tissue were investigated in order to help explain the unique biocompatible properties of titanium implants and their successful osseointegration into bone tissue. In this study the influence of commercially pure titanium and titanium peroxy gels on the breakdown of the connective tissue component and serum derived factor, hyaluronan, by reactive oxygen species (ROS), produced during the insertion of an implant in vivo, was examined. Hyaluronan breakdown was monitored in vitro in the presence of a hydroxyl radical flux, generated in the presence and absence of titanium powder and discs. Parallel studies examined the breakdown of hyaluronan by hydroxyl radicals in the presence of a titanium peroxy gel, prepared by incubation of the titanium powder or discs in concentrated hydrogen peroxide. The hyaluronan degradation products were separated according to their hydrodynamic size by gel exclusion chromatography. Similarly, experiments were also performed examining the degradation of 2-deoxy-D-ribose by a hydroxyl radical flux in order to demonstrate the detrimental potential of the hydroxyl radicals and to provide a measure of the effectiveness of titanium and titanium peroxy gels as scavengers of ROS. Titanium reduced the harmful effects of the hydroxyl radicals on the breakdown of hyaluronan, presumably acting as a scavenger for the reactive species, possibly by absorbing them into its surface oxide layer, which spontaneously forms on the surface. In contrast, the formation of a titanium peroxy gel from the titanium powder or on the surface of titanium discs enhanced breakdown of both the hyaluronan chains and 2-deoxy-D-ribose. The implications of these findings with regards to the biocompatible nature of the titanium and the ability of these implants to successfully osseointegrate are discussed.

Biocompatible Materials↗

PubMed1996

Development of a finite element model of the middle ear.

A representative finite element model of the healthy ear is developed commencing with a description of the decoupled isotropic tympanic membrane. This model was shown to vibrate in a manner similar to that found both numerically (1, 2) and experimentally (8). The introduction of a fibre system into the membrane matrix significantly altered the modes of vibration. The first mode "remains as a piston like movement as for the isotropic membrane. However, higher modes show a simpler vibration pattern similar to the second mode but with a varying axis of movement and lower amplitudes. The introduction of a malleus and incus does not change the natural frequencies or mode shapes of the membrane for certain support conditions. When constraints are imposed along the ossicular chain by simulation of a cochlear impedance term then significantly altered modes can occur. More recently a revised model of the ear has been developed by the inclusion of the outer ear canal. This discretisation uses geometries extracted from a Nuclear Magnetic resonance scan of a healthy subject and a crude inner ear model using stiffness parameters ultimately fixed through a parameter tuning process. The subsequently tuned model showed behaviour consistent with previous findings and should provide a good basis for subsequent modelling of diseased ears and assessment of the performance of middle ear prostheses.

Biomechanical Phenomena↗

PubMed1995

Structural specificity of substrate for S-adenosylmethionine:protein arginine N-methyltransferases.

The enzymatic methylation of polypeptides on the guanidino group of internal arginine residues by S-adenosylmethionine:protein arginine N-methyltransferase (protein methylase I) yields NG-monomethylarginine, NG,NG-dimethylarginine and NG,NG-dimethylarginine. It has commonly been observed that these arginine residues are present in glycine-and-arginine rich motifs. To understand structural features which are essential for serving as the methyl acceptor for protein methylase I, we have investigated substrate capacities of several synthetic oligopeptides whose sequences are homologous and/or analogous to the methyl acceptor region of the naturally occurring arginine-methylated proteins. These studies have led to the following conclusions. (i) The preferred amino-acid sequence of methyl-accepting peptides was shown to be an arginine-containing peptide with glycine in both the N- and C-flanking positions. While a tetrapeptide with such a sequence (residues 106-109 of bovine myelin basic protein) exhibited almost negligible substrate activity, an overlapping hexapeptide was a moderate substrate. (ii) Substitution of the C-flanking glycine in GKGRGL (residues 104-109 of myelin basic protein) with histidine, phenylalanine, lysine or aspartic acid completely abolished the ability of these hexapeptides to serve as substrates. (iii) A heptapeptide with a repeated glycine-arginine motif (GRGRGRG) was an excellent substrate for the enzyme. (iv) A cyclic octapeptide (CGKGRGLC), which was formed by cyclization of GKGRGL by introduction of disulfide bridge to cross-link N- and C-terminus of the hexapeptide, was an even better substrate than the hexapeptide. (v) Upon HPLC amino-acid analysis, all enzymatically methyl-14C-labeled oligopeptides were found to yield predominantly NG-monomethylarginine with a minor fraction of NG,NG-dimethylarginine in certain peptide samples. However, no NG,NG-dimethylarginine formation was detectable. (vi) The recombinant hnRNP protein A1 (residues 1-320) is known to be methylated at arginine-194 by nuclear-protein/histone protein methylase I (Rajpurohit et al. (1994) J. Biol. Chem. 269, 1079-1082). However, the hexapeptide (SSSQRG) which corresponds to residues 189-194 of protein A1 containing the methylatable arginine residue was relatively inert as a substrate. Furthermore, the N-terminal fragment of protein A1 (residues 1-196) generated by controlled trypsin digestion was also completely inactive as a substrate for the enzyme. These results indicate that the remainder of the A1 protein molecule plays an important though not yet understood role in enzymatic methylation of the arginine-194.

Amino Acid Sequence↗

PubMed1995

Multiple RNA binding domains (RBDs) just don't add up.

One of the most common motifs for binding RNA in eukaryotes is the RNA binding domain (RBD) or RNA Recognition Motif (RRM). One of the more intriguing aspects of these proteins is their modular nature. Proteins have been found containing from one to four RRMs. In most instances, these domains have some basal level of non-sequence specific RNA binding affinity. In addition, many also have a higher affinity for a specific structure or sequence of RNA. In the cases of heterogenous nuclear ribonucleoprotein A1 (hnRNP A1), yeast poly-A binding protein and splicing factor U2AF65, the individual free energy of binding of the RBDs for RNA are not strictly additive. By invoking a model in which the amino acids connecting adjoining RBDs are considered to be flexible linkers with an interresidue spacing of about 3.5 A, it is possible to predict the apparent association constants for at least some multi-RBD proteins to single-stranded RNA. We have surveyed the literature and found that individual RBDs are separated by 'linker' sequences of highly variable length. These linkers provide a critical determinant of binding affinity and may modulate cis versus trans binding. A clearer understanding of multi-RBD binding is essential to critically evaluating the role of these proteins in RNA splicing, packaging and transport.

Amino Acid Sequence↗