Search PubMed⌕ Search

Biomedical subjects

K Ogata

Publications and source records attributed to K Ogata.

At least 109 records · Page 6Linked to original sources
PubMed1999

[Prandial hypoxia in progressive muscular dystrophy].

Progressive muscular dystrophy patients often show progressive body weight loss in early adolescence. This severe body weight loss frequently causes superior mesenteric artery syndrome which may result in a fatal outcome. We performed prandial pulse oximetry and found 12 out of 35 Duchenne muscular dystrophy patients, 1 out of 2 Becker muscular dystrophy patients and 1 out of 3 Limb-Girdle muscular dystrophy patients showed prandial hypoxia with tachycardia. The patients became tired and eating habits were easily interrupted resulting in progressive body weight loss. Nasal administration of 0.2L/min oxygen to 2 Duchenne muscular dystrophy patients, and nasal intermittent positive pressure ventilation to 2 Duchenne muscular dystrophy patients, 1 Becker muscular dystrophy patient and 1 Limb-Girdle muscular dystrophy patient for 15-30 minutes before eating improved the prandial hypoxia and halted the progression of body weight loss. This prandial hypoxia is one of the earliest signs of respiratory failure in progressive muscular dystrophy.

Adolescent↗
PubMed1999

Transtrochanteric curved varus femoral osteotomy for spondyloepiphyseal dysplasia tarda. A case report.

A female with spondyloepiphyseal dysplasia (SED) tarda suffered bilateral hip pain since about the age of ten. Her radiographs revealed subluxation and irregularity of the hip joints with acetabular dysplasia. Transtrochanteric varus osteotomy was performed on her left femur at 13 years of age and on her right femur at 14 years of age. The congruities of both hips improved after surgery. At follow-up, she had no pain in either hip even after walking for an extended period. Improved activity in daily life was noted.

Adolescent↗
PubMed1999

[A case of spinal myoclonus associated with epidural block for lumbago].

We herein report a case of spinal myoclonus following the administration of epidural anesthesia. A 25-year-old woman underwent lumbar epidural anesthesia because of lumbago and cramps in her left lower limb. She immediately felt a lancinating pain in her left limb during anesthesia at the level of L 4/5 and soon developed myoclonus in her left thigh. The neurological examination revealed rhythmic myoclonus in the left quadriceps and adductor thigh muscles. The myoclonus disappeared after performing a blockade of the left L 4 spinal root by using 1.5 ml of 1% lidocaine. An injury to the left L 4 nerve root during the epidural anesthesia possibly caused an abnormal transmission of the impulses or ectopic hyperexcitability in the nerve root, which might lead to the disturbance of the spinal inhibitory interneurons and hyperexcitability of the anterior horn cells causing myoclonus. Since she did not demonstrate any muscular weakness, nor sensory loss during the lidocaine block, the 1% lidocaine appeared to block the sympathetic nerves or to suppress the ectopic hyperexcitability. The sympathetic nerves may be involved in the development of her spinal myoclonus.

Adult↗
PubMed1999

[Surgical repair for ischemic mitral regurgitation: a method of mitral valve plasty with evaluation of morphological changes of mitral valve].

We evaluated a method of mitral valve plasty (MVP) for ischemic mitral regurgitation (IMR) by examining the morphological changes of the mitral valve. From November 1992 to May 1998, 8 patients (M : F = 4/4, age 44-79 years, mean age 65.1 years) with IMR underwent surgical repair. Preoperative mitral regurgitation (MR) was grade III of Sellers classification in 7 patients and grade IV in 1 patient. The cause of MR was mitral valve annular dilatation in 4 patients, mitral valve prolapse due to papillary muscle elongation in 2 patients, and partial papillary muscle rupture (PMR) in 2 patients. Cardiac surgery consisted of CABG + MVP in 7 patients and MVP in 1 patient. Mitral valve repair was separated into three types. Repair for annular dilatation consisted of commissuroplasty in 3 patients (2 patients Kay method, 1 patient Reed method) and ring annuloplasty using a Carpentier-Edwards ring (C-E ring) in 1 patient. Repair for papillary muscle elongation consisted of papillary muscle shortening and ring annuloplasty using a C-E ring. Repair for partial PMR consisted of papillary muscle implantation and ring annuloplasty for anterior leaflet prolapse in 1 patient, and quadrangular resection, posterior leaflet plasty (McGoon method) and ring annuloplasty in 1 patient. There was no hospital death. Postoperative outcome was 6 patients with no MR and 2 patients with grade II MR, but they were well-controlled with medication. Based on the morphological changes of the mitral valve, it is considered that MVP for IMR is an effective and recommended procedure.

Adult↗
PubMed1999

[Pulmonary radiation injury manifested by signs of bronchiolitis obliterans with organizing pneumonia after postoperative breast cancer radiotherapy].

A 67-year-old woman underwent surgery for cancer of both breasts (right: mastectomy, left: conserving surgery), and received 60 Gy radiation to the left postoperative breast. Three months later, cough and fever developed. A chest radiograph demonstrated infiltrative shadows in the left lung field. Transbronchial lung biopsy specimens disclosed organizing exudates in the alveolar spaces and bronchioles. After treatment with prednisolone, the clinical symptoms and radiographic infiltrates disappeared. This was a case of pulmonary radiation injury pathologically manifested by signs of bronchiolitis obliterans with organizing pneumonia.

Aged↗
PubMed1999

Oral administration of leflunomide (HWA486) results in prominent suppression of immunoglobulin E formation in a rat type 1 allergy model.

Leflunomide, a drug being developed for use in the treatment of rheumatoid arthritis, was evaluated in an ovalbumin (OVA)-induced rat type 1 allergy model. In a dose of 1 mg/kg/day, it strongly suppressed the formation of OVA-specific IgE, thus preventing the elevation of the plasma histamine level and induction of anaphylactic shock observed after i.v. challenge with OVA. Studies on leflunomide's effects on the secondary antibody response showed that administration during the primary immune response remarkably diminished the secondary antibody responses, except IgM, even without further drug administration. Furthermore, when administered during the secondary response after rechallenge, both the total IgE and OVA-specific IgE serum levels declined rapidly to nearly baseline levels. Although OVA-specific IgG1, IgG2a, and IgM did not decrease from their primary response levels, these classes' secondary responses were strongly suppressed. In an in vitro study, the proliferation and antibody production of OVA-stimulated spleen cells, derived from Brown Norway rats, were strongly inhibited by A77 1726, leflunomide's active metabolite. When uridine was added to the cell culture, this molecule's effect on cell proliferation was completely restored, whereas the antibody production was partially restored. These findings are consistent with data indicating that leflunomide is a dihydroorotate dehydrogenase inhibitor. Taken together, the above findings suggest the therapeutic potential of leflunomide against type 1 allergic diseases.

Administration, Oral↗
PubMed1998

Mg2+ binding and catalytic function of sphingomyelinase from Bacillus cereus.

The modes of Mg2+ binding to SMase from Bacillus cereus were studied on the basis of the changes in the tryptophyl fluorescence intensity. This enzyme was shown to possess at least two binding sites for Mg2+ with low and high affinities. The effects of Mg2+ binding on the enzymatic activity and structural stability of the enzyme molecule were also studied. The results indicated that the binding of Mg2+ to the low-affinity site was essential for the catalysis, but was independent of the substrate binding to the enzyme. It was also indicated that the alkaline denaturation of the enzyme was partly prevented by the Mg2+ binding, whereas no significant protective effect was observed against the denaturation by urea. The pH dependence of the kinetic parameters for the hydrolysis of micellar HNP and mixed micellar SM with Triton X-100 (1:10), catalyzed by SMase from B. cereus, was studied in the presence of a large amount of Mg2+ to saturate both the low- and high-affinity sites. The pH dependence curves of the logarithm of 1/Km for these two kinds of substrates were similar in shape to each other, and showed a single transition. On the other hand, the shapes of the pH dependence curves of the logarithm of kcat for these two kinds of substrates were different from each other. The pH dependence curve for micellar HNP showed three transitions and, counting from the acidic end of the pH region, the first and third transitions having tangent lines with slopes of +1 and -1, respectively. On the other hand, the curve for mixed micellar SM with Triton X-100 showed one large transition with a slope of +1 (the first transition) and a very small transition (the third transition). On the basis of the present results and the three-dimensional structure of bovine pancreatic DNase I, which has a primary structure similar to that of B. cereus SMase, we proposed a catalytic mechanism for B. cereus SMase based on general-base catalysis.

Animals↗
PubMed1998

Crystal structure of methionine aminopeptidase from hyperthermophile, Pyrococcus furiosus.

The structure of methionine aminopeptidase from hyperthermophile Pyrococcus furiosus (PfMAP) with an optimal growth temperature of 100 degreesC was determined by the multiple isomorphous replacement method and refined in three different crystal forms, one monoclinic and two hexagonal, at resolutions of 2.8, 2.9, and 3.5 A. The resolution of the monoclinic crystal form was extended to 1.75 A by water-mediated transformation to a low-humidity form, and the obtained diffraction data used for high-resolution structure refinement. This is the first description of a eukaryotic type methionine aminopeptidase structure. The PfMAP molecule is composed of two domains, a catalytic domain and an insertion domain, connected via two antiparallel beta-strands. The catalytic domain, which possesses an internal 2-fold symmetry and contains two cobalt ions in the active site, resembles the structure of a prokaryotic type MAP from Escherichia coli (EcMAP), while the structure of the insertion domain containing three helices has a novel fold and accounts for a major difference between the eukaryotic and prokaryotic types of methionine aminopeptidase. Analysis of the PfMAP structure in comparison with EcMAP and other mesophile proteins reveals several factors which may contribute to the hyperthermostability of PfMAP: (1) a significantly high number of hydrogen bonds and ion-pairs between side-chains of oppositely charged residues involved in the stabilization of helices; (2) an increased number of hydrogen bonds between the positively charged side-chain and neutral oxygen; (3) a larger number of buried water molecules involved in crosslinking the backbone atoms of sequentially separate segments; (4) stabilization of two antiparallel beta-strands connecting the two domains of the molecule by proline residues; (5) shortening of N and C-terminal tails and stabilization of the loop c3E by deletion of three residues.

Amino Acid Sequence↗
PubMed1998

The role played by environmental residues on sidechain torsional angles within homologous families of proteins: a new method of sidechain modeling.

We investigated the conservation of sidechain conformation for each residue within a homologous family of proteins in the Protein Data Bank (PDB) and performed sidechain modeling using this information. The information was represented by the probability of conserved sidechain torsional angles obtained from many families of proteins, and these were calculated for a pair of residues at topologically equivalent positions as a result of structural alignment. Probabilities were obtained for a pair of same amino acids and for a pair of different amino acids. The correlation between environmental residues and the fluctuation of probability was examined for the pair of same amino acid residues, and the simple probability was calculated for the pair of different amino acids. From the results on the same amino acid pairs, 17 amino acids, except for Ala, Gly, and Pro, were divided into two types: those that were influenced and those that were not influenced by the environmental residues. From results on different amino acid pairs, a replacement between large residues, such as Trp, Phe, and Tyr, was performed assuming conservation of their torsional angles within a homologous family of proteins. We performed sidechain modeling for 11 known proteins from their native and modeled backbones, respectively. With the native backbones, the percentage of the chi 1 angle correct within 30 degrees was found to be 67% and 80% for all and core residues, respectively. With the modeled backbones, the percentage of the correct chi 1 angle was found to be 60% and 72% for all and core residues, respectively. To estimate an upper limit on the accuracy for predicting sidechain conformations, we investigated the probability of conserved sidechain torsional angles for highly similar proteins having > 90% sequence identity and < 2.5-A X-ray resolution. In those proteins, 83% of the sidechain conformations were conserved for the chi 1 angle.

Amino Acid Sequence↗
PubMed1998

Thermodynamics of specific and non-specific DNA binding by the c-Myb DNA-binding domain.

The thermodynamics of the c-Myb DNA-binding domain (R2R3) interaction with its target DNA have been analyzed using isothermal titration calorimetry and amino acid mutagenesis. The enthalpy of association between the standard R2R3, the Cys130 mutant substituted with Ile, and the cognate DNA is -12.5 (+/- 0.1) kcal mol-1 at pH 7.5 and at 20 degrees C, and this interaction is enthalpically driven throughout the physiological temperature range. In order to understand the DNA recognition mechanism, several pairs of interactions were investigated using single and multiple-base alterations with single and multiple-amino acid substituted mutants. The interactions between the standard R2R3 and many non-cognate DNAs were accompanied by binding enthalpy changes and heat capacity changes, although their affinities were reduced. The roles of the electrostatic interactions in binding to the cognate and the non-cognate DNAs were also analyzed from the dependency of the thermodynamic parameters on the salt concentration. The heat capacity change was found to be significantly dependent upon the salt concentration. Several mutant proteins bound to the multiple-base altered DNA with very small enthalpy changes, although they bound to the cognate and the single-base altered DNAs with detectable enthalpy and heat capacity changes. From the thermodynamic cycles derived from the DNA binding of the amino acid substituted R2R3 to the base substituted DNA duplexes, the individual thermodynamic mechanisms of the specific DNA recognition of R2R3 were dissected. The local folding mechanism was highlighted by the substitution of Pro with either Gly or Ala at the linker between R2 and R3. The characteristic thermodynamic features of specific and non-specific DNA binding are discussed.

Amino Acid Substitution↗
PubMed1998

Repeated cycles of G-CSF-combined postremission chemotherapy for acute myeloid leukemia in a first complete remission: a pilot study.

The cure rate of acute myeloid leukemia might increase if G-CSF were given concurrently with repeated postremission chemotherapy. However, this therapy might cause severe complications, including depletion of normal hematopoietic progenitors as a long-term toxicity. Thus, we conducted a pilot study of this strategy. Twenty-six acute myeloid leukemia patients in a first complete remission (CR) were treated with two courses of consolidation chemotherapy (10-day BHAC-DMP, consisting of behenoyl cytosine arabinoside, daunorubicin, 6-mercaptopurine and prednisolone) and repeated maintenance-intensification therapy including eight cycles of six-day BHAC-DMP. G-CSF (filgrastim) was administered concurrently with these BHAC-DMP therapies. Toxicity during the therapeutic period was not significant in the study group compared with the historical control, treated with the same regimen without G-CSF. Neutrophil recovery after the consolidation therapy was more rapid in the study group than in the historical control (p = 0.066 and 0.024 for the first and second consolidation courses, respectively). Long-term toxicity, such as cytopenia, has not been seen in eight patients who have remained in CR for a long period (range: 39-58 months). At a median follow-up of 39 months, the predicted rate of 42-month CR duration for these 26 patients was 50% (95% confidence limits: 30% to 71%). We conclude that G-CSF-combined repeated BHAC-DMP postremission therapy is feasible. Full elucidation of the clinical benefit of this strategy will require further study.

Acute Disease↗
PubMed1998

[Assessment of saphenous vein graft wall characteristics with intravascular ultrasound imaging].

The wall characteristics of saphenous vein grafts (SVGs) after coronary artery bypass grafting (CABG) were assessed with intravascular ultrasound (IVUS) imaging. Twenty-seven SVGs in 25 patients who had undergone CABG were studied with IVUS in vivo. Ten SVGs excised from 6 patients who had undergone reoperation were studied with IVUS in vitro. The results were compared with the histopathologic findings. IVUS images of four SVGs studied within 1 month after CABG showed a thin and single-layer structure, which was almost identical to the IVUS features of a normal, fresh SVG. In five SVGs studied between 3 months and 1 year after CABG, the wall thickness was increased, and there were hypoechoic areas. In sixteen SVGs studied more than 2 years after CABG, two patterns were noted on IVUS imaging. One pattern was a triple-layer structure of alternating hyperechoic, hypoechoic, and hyperechoic bands seen in the angiographically normal sections of the SVGs. The second pattern was a heterogeneous, echogenic monolayer found in the angiographically irregular and diseased sections of the SVGs. Comparison of the in vitro IVUS images with the histopathology of the SVGs showed a strong correlation between the triple-layer structure and fibrointimal proliferation, and between the heterogeneous monolayer and atherosclerosis. In conclusion, IVUS is useful for assessing SVGs and for long-term qualitative monitoring of vein graft disease after CABG.

Coronary Artery Bypass↗
PubMed1998

[Successful management of aorto-esophageal fistula due to rupture of thoracic aortic aneurysm in an elderly patient].

Aorto-esophageal fistula due to ruptured thoracic aortic aneurysm is very rare but is associated with extremely high mortality. An 81-year-old woman was admitted due to repeated hematemesis. Endoscopic examination revealed ulceration with blood clot on the mid-esophagus and compression of an extra-esophageal mass. The thoracic CT scan revealed an aorto-esophageal fistula due to a ruptured descending thoracic aortic aneurysm. Surgery was performed on April 3, 1996. We report an aorto-esophageal fistula managed successfully in one stage by resection and replacement of the aortic aneurysm with a prosthetic graft and total esophageal resection. The esophagus was reconstructed using orthotopic gastric interposition with omentopexy around the prosthetic aortic graft. The postoperative course was uneventful and there have been no signs of mediastinal sepsis, graft infection or pyothorax 12 months postoperatively. We suggest that the resection of both the aneurysm and the esophagus as well as the immediate reconstruction of the esophagus by orthotopic gastric interposition to obliterate the retrosternal space are important technique in the management of intrathoracic infections.

Aged↗
PubMed1998

Phase II trial of combination chemotherapy with cisplatin, carboplatin and etoposide in stage IIIB and IV small-cell lung cancer. Fukuoka Lung Cancer Study Group.

PURPOSE: A phase II trial combining cisplatin, carboplatin and etoposide was conducted in previously untreated patients with stage IIIB and IV small-cell lung cancer, in an attempt to increase response rates and prolong survival. METHODS: Previously untreated patients with small-cell lung cancer, with measurable disease, aged < or = 72 years, performance status < or = 2, and adequate hematologic, hepatic and renal function were enrolled in the study. They were treated with 80 mg/m2 cisplatin on day 1, 100 mg/m2 carboplatin on days 2, 3 and 8, and 50 mg/m2 etoposide on days 1, 2, 3 and 8. RESULTS: A total of 46 patients (20 with stage IIIB and 26 with stage IV disease) were enrolled in the study. A total of 186 courses of chemotherapy were given, and the dose was reduced in 27 courses (15%). The chemotherapy was repeated for four or more courses in 30 patients. There were 10 complete responses and 32 partial responses, for a total response rate of 91% (95% confidence interval, 79% to 98%). The median survival time and 2-year survival rates were 18 months and 22% for stage IIIB disease, and 14 months and 15% for stage IV disease. Major side effects were hematologic: leukopenia, anemia, and thrombocytopenia of grade 3 or more occurred in 48%, 46%, and 43% of patients, respectively. CONCLUSIONS: The three-drug regimen of cisplatin, carboplatin and etoposide is feasible and active against small-cell lung cancer.

Aged↗
PubMed1998

Transcriptional regulation of the Prevotella ruminicola recA gene.

The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level. P. ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region. At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents, mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress. No induction was detected when growth of P. ruminicola was arrested by shifting to acidic (pH 4.8) conditions. Primer extension experiment revealed the three very close transcriptional start sites for recA. The putative -10 and -35 RNA polymerase binding regions were proposed on the basis of transcript mapping. These regions bear very little similarity to the E. coli (sigma70) and B. subtilis (sigmaA) consensus sequences, as well as to the recognition sites of other minor sigma-factors. Transcript mapping experiments in E. coli expressing P. ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription. Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative -10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P. ruminicola. This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E. coli and other Gram-negative bacteria.

Animals↗
PubMed1998

Tissue factor is associated with the nonbacterial thrombotic endocarditis induced by a hypobaric hypoxic environment in rats.

High-altitude hypoxia causes a hypercoagulable state. In our previous study on the blood coagulation system in rats, nonbacterial thrombotic endocarditis (NBTE) developed after 4-12 weeks' exposure to the equivalent of 5500 m in altitude. We hypothesized that TF (tissue factor)-producing cells in the cardiac valves might be induced by the hypobaric hypoxic environment (HHE) and then trigger NBTE. A total of 170 male Wistar rats were housed in a chamber at the equivalent of 5500 m altitude for 1-12 weeks. We measured TF activity in the plasma and studied morphological changes in the mitral valves using immunohistochemical and immunoelectrical methods for TF protein and in situ hybridization for TF mRNA. After 4 weeks or more of exposure to HHE, 28 of the 56 surviving rats had developed NBTE. After 4-8 weeks' exposure to HHE, the plasma TF activity level was significantly higher than in control rats. There was a significant correlation between plasma TF activity and the incidence of NBTE. After 1 weeks' exposure to HHE, immunoreactivity for TF protein was detected in foamy macrophages and stromal cells in the cardiac valves. In rats with NBTE, TF protein was present in foamy macrophages and spindle stromal cells and focally present in the extracellular matrix. TF mRNA was detected in some foamy macrophages within the thrombus, TF protein was localized to the rough endoplasmic reticulum and plasma membrane of many macrophages, some fibroblasts, and a few endocardial cells. TF is associated with the pathogenesis of the NBTE induced by exposure to HHE. The accumulation of TF-producing macrophages during exposure to HHE may be responsible for initiating thrombus formation.

Animals↗