Search PubMed⌕ Search

Biomedical subjects

K Morohashi

Publications and source records attributed to K Morohashi.

At least 55 records · Page 3Linked to original sources
PubMed1995

Ad4BP in the human adrenal cortex and its disorders.

Ad4BP, a zinc finger DNA-binding protein, is a transcription factor that regulates the expression of the steroidogenic P450 genes. We performed immunoblotting and immunohistochemistry of Ad4BP in 34 human adrenal cortex specimens, which included adrenocortical adenomas and carcinomas. Immunoblotting revealed a single band of 53K, corresponding to the mol wt of Ad4BP. The immunohistochemical studies demonstrated that Ad4BP immunoreactivity was present exclusively in the nuclei of nearly all of the adrenocortical parenchymal cells in both the normal and the pathological human adrenal specimens. Ad4BP was immunostained with equal intensity and frequency among the different cell types. Ad4BP immunoreactivity was also observed in areas of marked degenerative changes, such as lipomyelomatous lesions, and in poorly differentiated carcinoma cells. These results suggest a close association of Ad4BP expression with the biological phenotype of adrenocortical parenchymal cells. Ad4BP therefore seems to play important roles in the induction and maintenance of the transcription of all steroidogenic P450 genes in human adrenocortical cells, even after malignant transformation.

Adenoma↗
PubMed1995

Immunohistochemical localization of Ad4-binding protein with correlation to steroidogenic enzyme expression in cycling human ovaries and sex cord stromal tumors.

Ad4-binding protein (Ad4BP) has been demonstrated recently as a transcription factor that serves as a general regulator of all steroidogenic P450 genes. We examined the expression of Ad4BP in 32 normal cycling human ovaries and 22 human ovarian sex cord stromal tumors by immunoblotting and immunohistochemistry. Immunoblotting of normal cycling human ovaries revealed a single band of 53 kilodaltons, corresponding to the mol wt of Ad4BP. We also correlated Ad4BP expression with the immunolocalization of the steroidogenic enzymes (side-chain cleavage cytochrome P450, cytochrome P450 17 alpha-hydroxylase, and cytochrome P450 aromatase). Ad4BP immunoreactivity, which was present only in the nuclei, was observed sporadically in the granulosa cells and adjacent stromal cells in the preantral follicles. In the dominant antral follicles, Ad4BP was detected in both granulosa and theca interna cells. However, in the nondominant antral follicles, Ad4BP was observed only in theca interna cells. In the corpus luteum, Ad4BP was present in both luteinized granulosa and thecal cells. Ad4BP was also expressed in some atretic follicles and degenerating corpora lutea. The spatial and temporal localization of Ad4BP in the normal cycling human ovary generally correlated well with that of steroidogenic enzymes. However, expression of the steroidogenic enzymes followed that of Ad4BP during the developing stages of the preantral follicle and vice versa during the process of follicular atresia. In ovarian sex cord stromal tumors, Ad4BP expression was observed in tumor cells that were positive for steroidogenic enzymes, but not in nonsteroidogenic tumor cells. These results, especially the in situ colocalization of Ad4BP and the steroidogenic enzymes, suggest that Ad4BP has the potential to control steroidogenic P450 expression in both normal and pathological human ovaries.

Adult↗
PubMed1994

Contribution of Ad4BP, a steroidogenic cell-specific transcription factor, to regulation of the human CYP11A and bovine CYP11B genes through their distal promoters.

We analyzed the upstream regions of the human CYP11A and bovine CYP11B genes, and identified a distal promoter in each gene. The distal promoters are located at -1.8 to -1.5 kb in the upstream region of the CYP11A gene and -1.5 to -1.1 kb in the upstream region of the CYP11B gene. Transient transfection of CAT plasmid carrying each of the two distal promoters indicated that the regions had a transcriptional activating function and that the function was stimulated by cAMP. The basal and cAMP-stimulated transcriptional activities were detected only in steroidogenic cells. On structural analyses of the regions, we identified two Ad4 sites and a cAMP responsive element in the distal promoter of CYP11A, and two Ad4 sites and one NF-IL6 binding site in the distal promoter of CYP11B. The presence of an Ad4 site in common suggests its major contribution of the transcriptional activation. We also investigated the functional interactions between the distal promoters and basal promoters of both genes. Interestingly, the two distal promoters showed different requirements as to the basal promoter.

Animals↗
PubMed1994

Functional difference between Ad4BP and ELP, and their distributions in steroidogenic tissues.

Ad4BP, a zinc finger DNA-binding protein, was identified as a transcription factor regulating steroidogenic P-450 genes in a cAMP-dependent manner. Immunochemical and immunohistochemical studies with steroidogenic tissues, adrenal, ovary, and testis, were performed using the antiserum to Ad4BP. Ad4BP was expressed to the same extent in the three zones of the adrenal cortex. Immunohistochemical examination of ovarian follicle and corpus luteum showed the expression of Ad4BP. The granulosa and thecal cells, the two distinct types of the steroidogenic cells in the follicle, gave Ad4BP signals, which were stronger than in the latter cells than in the former. Immunoblot analyses of mature and regressed corpora lutea indicated a parallel expression of Ad4BP and side-chain cleavage P-450, and both proteins significantly decreased in the regressed tissues. Leydig cells surrounding seminiferous tubules gave clear immunostaining signals for Ad4BP. ELP, a mammalian counterpart of Drosophila FTZ-F1 detected in EC cells, and are isoforms transcribed from the same gene. The Ad4BP and ELP forms recognize same nucleotide sequences. Reverse transcriptase-polymerase chain reaction with specific primers for ELP revealed that steroidogenic tissues contained ELP as well as Ad4BP. The effects of the two proteins on the transcription of the CYP11B gene were compared using the expression vectors of Ad4BP and ELP. ELP did not activate transcription and showed a weak inhibitor effect on the Ad4BP-dependent transactivation of the CYP11B gene promoter when transfected simultaneously. A gel shift analysis using in vitro synthesized Ad4BP and ELP revealed that the binding activity of ELP is significantly weaker than that of Ad4BP.

Adrenal Cortex↗
PubMed1994

Sex-dependent expression of a transcription factor, Ad4BP, regulating steroidogenic P-450 genes in the gonads during prenatal and postnatal rat development.

We investigated the expression of Ad4BP (also known as SF-1), a transcription factor regulating steroidogenic P-450 genes, in the steroidogenic tissues such as adrenal glands, testes and ovaries through the prenatal and postnatal life of rats. Ad4BP was detected in the primordial adrenal glands and gonads of the 13.5 day postcoitum (d.p.c.) fetus. After the appearance of Ad4BP, a steroidogenic P-450 (P-450(SCC)) was also detected in the adrenal glands and its amount increased gradually. In the fetal gonads of 14.5 d.p.c., a significant amount of Ad4BP was detected in the somatic cells of the testes, whereas only a trace amount was present in the ovaries. The sexually dimorphic expression of Ad4BP continued throughout the neonatal age. Drastic alterations occurred during the first to third week of postnatal age accompanied by functional and structural changes of the gonads. The expression of Ad4BP in the testes attained a maximal level one week after birth and decreased markedly thereafter. By contrast, increase of Ad4BP in the ovary was detected after the first postnatal week. Expression of P-450c17 showed a good correlation with the proliferation of Leydig cells in the testes and theca cells in the ovaries. Immunohistochemical studies revealed the presence of Ad4BP in Sertoli cells as well as Leydig cells up to the pubertal age. In the adult rat testis, however, staining of Sertoli cells decreased significantly. Ad4BP was detected in granulosa, theca, corpus luteum and interstitial gland cells in the ovary although the expression levels in granulosa cells varied among follicles. It is suggested that the Müllerian inhibitory substance gene may be a target of Ad4BP since this gene has a conserved Ad4-binding site within the promoter, which is recognized by Ad4BP expressed in the fetal testes.

Adrenal Glands↗
PubMed1993

Ad4BP regulating steroidogenic P-450 gene is a member of steroid hormone receptor superfamily.

Bovine cytochrome P-450(11 beta) gene (CYP11B) has six different cis-acting elements, Ad1, Ad2, Ad3, Ad4, Ad5, and Ad6, in the promoter region. The Ad4 site also exists in the promoter regions of other steroidogenic P-450 genes as well as in CYP11B1. An Ad4-binding protein (Ad4BP) which specifically binds to the Ad4 site was purified from bovine adrenal cortex nuclear extract, and its molecular mass was 53 kDa. A complementary DNA encoding Ad4BP was isolated from a bovine adrenal cortex cDNA library. The cDNA clone contained an open reading frame of 1383 base pairs encoding 461 amino acids, whose calculated molecular weight was 51,020. The predicted amino acid sequence of Ad4BP revealed that the protein has a zinc finger domain and a ligand binding/dimerization domain. Ad4BP is a novel member of the steroid hormone receptor superfamily. Comparison of the primary structures of the hormone receptor superfamily showed that Ad4BP was highly homologous to FTZ-F1, which regulates the fushi tarazu gene, and ELP, which is expressed in the murine embryonal carcinoma cells. Transfection of a Ad4BP expression plasmid into CV-1 cells activated the transcription of the CAT reporter gene carrying the Ad4 sequence in the promoter region.

Amino Acid Sequence↗
PubMed1993

Three forms of rat CYP11B genes: 11 beta-hydroxylase gene, aldosterone synthase gene, and a novel gene.

We isolated three genomic clones of rat P-450(11 beta) genes (CYP11B). Two of them corresponded to 11 beta-hydroxylase gene (CYP11B1) and aldosterone synthase gene (CYP11B2), respectively. The third one was a novel gene resembling both CYP11B1 and CYP11B2, and was named CYP11B3 gene (CYP11B3). CYP11B2 and CYP11B3 are located tandemly in the genome in the same direction approximately 24 kb apart. These three genes were highly homologous in their amino acid coding regions, with 88% (CYP11B1 to CYP11B2), 89% (CYP11B2 to CYP11B3), 96% (CYP11B1 to CYP11B3) nucleotide identity. The numbers and the locations of the exons of these three genes also exactly corresponded to each other. However, the nucleotide sequences of the 5' upstream regions of CYP11B1 and CYP11B2 were significantly different, suggesting different transcriptional regulations. CYP11B3 had almost the same sequence as CYP11B1 gene in the 5' upstream region. A putative Ad4 site, a cis-acting element present in the promoter regions of all the steroidogenic P-450s so far reported [Morohashi, K., Honda, S., Inomata, Y., Handa, H., Omura, T. (1992) J. Biol. Chem. 267, 17913-17919], was found in the promoter regions of both CYP11B1 and CYP11B2. Gel retardation analysis showed the binding of Ad4BP purified from bovine adrenal cortex to these two Ad4 sites. We analyzed the relative abundance of the mRNAs corresponding to these three genes by the generation of RT-PCR libraries from rat adrenal total RNAs.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acid Sequence↗
PubMed1993

Activation of CYP11A and CYP11B gene promoters by the steroidogenic cell-specific transcription factor, Ad4BP.

We have examined the transcriptional activity of four cis-elements, Ad1(CRE), Ad2, Ad3, and Ad4, that are present in the promoter of the bovine CYP11B (11 beta-hydroxylase P-450) gene using beta-globin reporter gene constructs and transient transfection into steroidogenic and nonsteroidogenic cell types. Only Ad1(CRE), a CRE homolog, showed forskolin-dependent transcriptional activity in adrenal tumor Y-1 cells, whereas the other elements were not able to stimulate transcription by themselves. As Ad3 and Ad4 had previously been identified as the cis-elements required for full cAMP-dependent transcription of this gene, we examined the effect of combinations of different cis-elements on the transcription of the reporter gene. In Y-1 cells, Ad1(CRE) and four tandem copies of any one of the other cis-elements substantially activated transcription in response to forskolin treatment. The template carrying Ad1(CRE) and Ad4 was also active in testicular Leydig cells, I-10, whereas it was inactive in nonsteroidogenic PC-12 cells. Transcriptional activation by the 4xAd4/Ad1(CRE) combination presumably depended on the presence of Ad4-binding protein (Ad4BP), which is absent in PC-12 cells, as shown by immunoblot analysis. This was confirmed by cotransfecting an expression vector for Ad4BP into PC-12 cells, which caused forskolin-dependent transcription to increase in proportion to the amount of expression vector. In Y-1 cells, transcriptional activation by forskolin was mimicked by cotransfection of an expression vector for the catalytic subunit of protein kinase-A.(ABSTRACT TRUNCATED AT 250 WORDS)

Adrenal Gland Neoplasms↗
PubMed1992

A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450s.

Previous studies of bovine CYP11B1 gene regulation revealed six cis-acting elements, Ad1, Ad2, Ad3, Ad4, Ad5, and Ad6, in the 5' upstream region of the gene. Ad4 site was a positive transcription element in the stimulation by cAMP. Ad4-binding protein (Ad4BP) was purified from the nuclear extract of bovine adrenal cortex using affinity latex particles conjugated with polymerized Ad4 sequences. The molecular mass of the purified Ad4BP estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis was approximately 53 kDa. To characterize the binding specificity of Ad4BP, oligonucleotides homologous to Ad4 sequence and AGGTCA containing sequences in the promoter regions of steroidogenic P-450s were synthesized and used for gel shift analyses as competitors. The competition experiments revealed that Ad4BP bound not only to (C/T)CAAGG(T/C)(C/T), which was originally identified as the Ad4 binding site, but also to (Pu)PuPuAGGTCA. All the steroidogenic P-450 genes examined had at least one Ad4BP binding sequence. Experiments with model sequences containing various nucleotide substitutions established that (C/T)CAAGG(T/C)CA is the strongest binding sequence for Ad4BP. The expression of Ad4BP was examined with adrenal cortex cells and several other steroidogenic and nonsteroidogenic cells. Only the steroidogenic cells, the granulosa cells of bovine ovary, and I-10 cells derived from mouse Leydig cells, expressed the binding activity to Ad4 site. The presence of Ad4 site as a common cis-acting element in the genes of all the steroidogenic P-450s and the steroidogenic tissue-specific expression of Ad4BP strongly suggests that Ad4BP is an indispensable transcription factor for the expression of all the steroidogenic P-450 genes.

Adrenal Cortex↗
PubMed1992

Functional expression of cDNAs for bovine 11 beta-hydroxylase-aldosterone synthases, P450(11 beta)-2 and -3 and their chimeras.

Two molecular species of bovine P450(11 beta), P450(11 beta)-2 and P450(11 beta)-3 have been identified, in which the amino acid differences were found at the 6th, 36th and 82nd positions from the NH2-termini of the mature proteins. They catalyzed the 11 beta-, 18- and 19-hydroxylation and aldosterone formation from 11-deoxycorticosterone, and the rate of production of 18-hydroxycorticosterone and aldosterone by P450(11 beta)-3 was greater than that by P450(11 beta)-2 [Morohashi et al., J. Biochem. 107 (1990) 635-640]. In this study, chimeric clones were constructed whose 6th, 36th and 82nd amino acid residues were exchanged with each other. Two original clones and six chimeric clones were expressed in COS-7 cells, and their steroidogenic activities studied. The ratio of aldosterone or 18-hydroxycorticosterone production to corticosterone production by one clone was compared with that of the other. The ratios for the four clones having Gly36 [P450(11 beta)-3 type] were 0.08-0.22, whereas those for the clones having Ser36 [P450(11 beta)-2 type] were 0.03-0.05, suggesting that the Gly36 structure is important for aldosterone production.

Animals↗
PubMed1992

Cooperative transcription activation between Ad1, a CRE-like element, and other elements in the CYP11B gene promoter.

We previously reported the presence of six different cis-acting elements (Ad1 to Ad6) in the promoter region of the bovine CYP11B gene. Although the Ad1 site (TGACGTGA) was similar to a palindromic CRE (TGACGTCA), two other upstream sequences, Ad3 and Ad4, were identified as the cAMP response sequences of the gene. We analyzed the functional relationship between the Ad1 site and the upstream elements. Mutation analyses of the Ad1 site indicated that the 5' half of the site (TGACG) was important for the transcription of the gene in vitro. In Y-1 cells, a plasmid with a mutated Ad1 showed no response to cAMP. The effect of the mutation at the Ad1 site on the cAMP response was almost the same as that of the deletion of Ad3 and Ad4, although the role of each element seemed to be different. These results indicated that both the Ad1 site and the upstream elements, Ad3 and Ad4, were necessary for the full response to cAMP of the CYP11B gene. When the Ad1 site in the promoter region was replaced with a palindromic CRE, elevated transcription activity was detected both in vitro and in vivo. Two kinds of CREBs (43 and 47 kDa) purified from a HeLa cell nuclear extract bound to the Ad1 site. The binding of the palindromic CRE to the nuclear factor(s) was stronger than that of Ad1.

Animals↗
PubMed1990

Structural organization of the bovine adrenodoxin gene.

The gene structure of bovine adrenodoxin (Ad), a component of the steroid hydroxylating system in adrenal cortex mitochondria, was determined. This gene seems to be a single copy, but contains a pseudo exon in addition to the genuine gene region. The gene region for the active Ad is divided into 4 exons by 3 introns, and spans at least 27 kb. All the splice donor and acceptor sites follow the GT/AG rule. The transcription initiation site was determined by primer extension analysis, and putative TATA and GC boxes are present in the 5'-flanking region. A 12 base sequence, CCAGGGCCAGGG, is present 95 bases upstream from the transcription initiation site. A similar sequence was also found in the 5'-flanking regions of all genes for the steroid hydroxylating cytochromes P-450: P-450(SCC), P-450(11 beta), P-450(17 alpha), and P-450(C21), in the adrenal cortex. The consensus sequence for these five sequences is CGCAGGGCCATGGGA. The pseudo exon, exon 1', was present about 0.5 kb upstream from exon 1. It encodes the prepeptide region of the minor type Ad mRNA, but has a stop codon (TAA) in the frame. A TATA-box-like sequence and a CAAT-box-like sequence are also present in the 5'-flanking region of exon 1'. The GC content of exon 1 was over 80%, whereas for each of the other four exons, including exon 1', it was about 40%. Our observations suggest that exon 1, which encodes the prepeptide region of the major type Ad mRNA, has intruded into the region between exon 1' and exon 2.

Adrenodoxin↗
PubMed1990

Enzymatic activities of P-450(11 beta)s expressed by two cDNAs in COS-7 cells.

Expression plasmids were constructed using two cDNA clones of P-450(11 beta), pcP-450-(11 beta)-2, and pcP-450(11 beta)-3 (Morohashi et al. (1987) J. Biochem. 102, 559-568 and Kirita et al. (1988) J. Biochem. 104, 683-686), and introduced into COS-7 cells by electroporation. The expression of P-450(11 beta) proteins and their localization in the mitochondria were demonstrated by immunoblotting, immunofluorescence microscopy, and immunoelectron microscopy. The enzymatic activities of the expressed P-450(11 beta)s were determined using deoxycorticosterone (DOC), deoxycortisol, and corticosterone as substrates. Though the activities of the two P-450(11 beta)s for 11-, 18-, and 19-hydroxylation of DOC were almost equal, the production of 18-hydroxycorticosterone and aldosterone from corticosterone by P-450(11 beta)-3 was greater than that by P-450(11 beta)-2.

Animals↗
PubMed1990

Structural analysis of multiple bovine P-450(11 beta) genes and their promoter activities.

A bovine genomic library was constructed using a cosmid vector, pHC79, and bovine DNA partially digested by EcoRI. Bovine P-450(11 beta) cDNA, pcP-450(11 beta)-2 [Morohashi et al. (1987) J. Biochem. 102,559-568], was used as a probe for screening the genomic library. Ten clones carrying P-450(11 beta) genomic DNA were isolated from 8 x 10(4) colonies and classified into five groups (CB11 beta-1, CB11 beta-3, CB11 beta-7, CB11 beta-20, and CB11 beta-21) according to differences in the restriction endonuclease sites. Nucleotide sequences of amino acid coding regions of the five clones were determined by the dideoxy sequencing method using synthetic nucleotides corresponding to various parts of the cDNA as primers. The nucleotide sequences revealed that three clones, CB11 beta-1, CB11 beta-3, and CB11 beta-21, were pseudogenes. Amino acid sequences coded by the other two clones, CB11 beta-7 and CB11 beta-20, were identical with that coded by a previously described cDNA, pcP-450(11 beta)-3 [Kirita et al. (1988) J. Biochem. 104, 683-686]. The promoter regions of the five clones were introduced in front of chloramphenicol acetyltransferase (CAT) gene of pSV00CAT and used to examine P-450(11 beta) gene regulation in cultured cells. The five recombinant plasmids showed cAMP-responsive CAT activities in Y-1 cells, a cell strain derived from adrenal tumor. The induction rates of the recombinant plasmids carrying the promoters of normal genes, CB11 beta-7 and -20, were larger than those of pseudogenes, CB11 beta-1, -3, and -21. CAT activities expressed by the promoter regions of the normal genes in the presence or absence of cAMP in Y-1 cells were almost equal to that by the promoter region of human P-450(SCC) gene. Though the promoter of the P-450(SCC) gene also showed cAMP-responsive CAT activity in I-10 cells, a cell strain derived from Leyding cell tumor, P-450(11 beta) gene promoter did not express the activity in I-10 cells.

Amino Acid Sequence↗
PubMed1990

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene.

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)

Adrenal Cortex↗
PubMed1990

Tissue-specific transcription of P-450(11 beta) gene in vitro.

The transcriptional activity of P-450(11 beta) gene was studied with an in vitro transcription system using nuclear extracts prepared from bovine adrenal cortex. Template plasmids were constructed with the promoter region of the bovine P-450(11 beta) gene and a G-less cassette as a reporter gene. Deletion analysis of the promoter region revealed two neighboring sites, Ad1 and Ad2, which are necessary for efficient transcription of the templates. These sites are highly conserved among bovine, mouse, and human genes. Though the Ad1 site, TGACGTGA, showed high homology to the consensus sequence of the cAMP-responsive element, TGACGTCA, with one base substitution, the Ad2 site showed no similarity to any regulatory element reported so far. Gel shift assay using synthetic nucleotides containing Ad1 and/or Ad2 indicated that three factors bound to these regions in adrenal cortex nuclear extract, two factors to Ad2 and one factor to Ad1. DNase I footprint analysis also showed the binding of factors to the Ad1 and Ad2 regions. Catenated synthetic nucleotides containing Ad1 and/or Ad2 inhibited the transcriptional activity of P-450(11 beta) gene. The P-450(11 beta) promoter expressed a stronger transcriptional activity in the nuclear extract of adrenal cortex than in that of liver. On the other hand, the promoter of alpha 1-antitrypsin gene, which is expressed only in liver, showed an opposite tissue specificity of transcription. Addition of adrenal cortex nuclear extract to liver nuclear extract activated specifically the P-450(11 beta) promoter in proportion to the quantity of adrenal cortex nuclear extract added.(ABSTRACT TRUNCATED AT 250 WORDS)

Adrenal Cortex↗