Search PubMed⌕ Search

Biomedical subjects

K Mitamura

Publications and source records attributed to K Mitamura.

At least 109 records · Page 6Linked to original sources
PubMed1993

[Ocular manifestations in human immunodeficiency virus seropositive patients].

Ocular manifestations in 56 human immunodeficiency virus (HIV) seropositive patients were examined prospectively. Eighteen of them had acquired immunodeficiency syndrome (AIDS), 14 had AIDS-related complex (ARC), and 30 were asymptomatic carriers (AC). Two AIDS patients progressed from ARC and four ARC patients from AC. Seventy-two percent of AIDS patients had ocular manifestations, including cotton-wool spots (28%), retinal hemorrhages (44%), cytomegalovirus retinitis (28%) and papilledema (6%). We also found ocular signs in 50% of ARC patients and 40% of AC patients. Since ophthalmologic manifestations are common in HIV seropositive patients, it is necessary for them to undergo a routine series of ophthalmologic examinations.

AIDS-Related Complex↗
PubMed1992

A new tumor-associated antigen useful for serodiagnosis of hepatocellular carcinoma, defined by monoclonal antibody KM-2.

After immunization of mice with the human hepatocellular carcinoma (HCC) cell line PLC/PRF/5, we produced monoclonal antibody KM-2, which allowed us to characterize a new HCC-associated antigen (KM-2 antigen) and to develop a sandwich-type radioimmunoassay. The KM-2 antigen was strongly expressed on the cell surface of HCC cell lines. Immunofluorescence staining of frozen sections of different tissues and tumors confirmed its specific expression on the cell surface of a group of HCC. The antigen was also detected in the bile canaliculi of normal liver. Its biochemical characterization revealed a high molecular weight (M(r) approximately 900,000) glycoprotein with an N-linked carbohydrate chain close to the peptide epitope recognized by the KM-2 monoclonal antibody. By the radioimmunoassay for the KM-2 antigen, the antigen was detected in sera of 72 (47%) of 154 patients with HCC and 3 (3%) of 102 patients with liver cirrhosis; it was not detected in 96 patients with chronic hepatitis or in 100 healthy control individuals. The positive rate of KM-2 antigen (72 of 154, 47%) was significantly (P less than 0.01) higher than that (51 of 154, 33%) of alpha-fetoprotein (AFP) when the cut-off level of AFP was taken as the widely accepted 400 ng/ml. No significant correlation was recognized between serum levels of the KM-2 antigen and AFP (r = 0.15; P greater than 0.05). In addition, among 103 patients with HCC whose AFP levels were less than 400 ng/ml, 31 (30%) were positive for the KM-2 antigen. Determination of the serum KM-2 antigen would be useful for the serodiagnosis of patients with HCC, particularly in cases with normal or low AFP levels.

Antibodies, Monoclonal↗
PubMed1992

Clinical application of the polymerase chain reaction for a rapid diagnosis of Mycobacterium tuberculosis infection.

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.

AIDS-Related Opportunistic Infections↗
PubMed1992

A randomized trial of reduced doses of azidothymidine in Japanese patients with human immunodeficiency virus type 1 infection.

Adverse reactions to the standard dose (1,200 mg/day-1,500 mg/day) of azidothymidine (AZT) are serious. An in vitro pharmacokinetic study of intracellular AZT-5'-triphosphate suggested the feasibility of a clinical trial with reduced doses of AZT. A randomized trial with reduced doses of AZT (group A; 400 mg/day, n = 15, group B; 800 mg/day, n = 13), was conducted enrolling 28 patients with human immunodeficiency virus infection. The effective rate of AZT on CD4+ lymphocyte counts was similar for both groups, but the duration of the effect of AZT was significantly longer in group A (p less than 0.05). In group B, adverse reactions were more frequently observed (p less than 0.01), and AZT was withdrawn or the dose was reduced more frequently (p less than 0.05). These results suggest that AZT at a dose of 400 mg/day is less toxic, and is more beneficial for long-term treatment.

Adolescent↗
PubMed1992

Human immunodeficiency virus DNA copies as a virologic marker in a clinical trial with beta-interferon.

The number of human immunodeficiency virus (HIV) DNA copies in peripheral blood mononuclear cells (PBMC) was quantitated by the polymerase chain reaction (PCR) and used as a virologic marker in a clinical trial with beta-interferon (beta-IFN) (6 x 10(6) IU/day administered intravenously for 4 weeks). In 11 HIV-infected patients who were clinically stable, the number ranged from 10 to 1,063 copies per 10(5) PBMC. However, percent change of the number in the individual untreated patients stayed between -46.2% and 203.0% of the basal level by one month interval. In six patients who were treated with beta-IFN, changes in the number were not significant before and after the trial.

Biomarkers↗
PubMed1991

Inhibition of human immunodeficiency virus type-1-induced syncytium formation and cytopathicity by complestatin.

Complestatin, an anti-complement agent, was shown to be a potent inhibitor of human immunodeficiency virus type 1 (HIV-1) infection in vitro. It inhibited HIV-1-induced cytopathicity and HIV-1 antigen expression in MT-4 cells; the 50% effective doses for these effects were 2.2 and 1.5 micrograms/ml, respectively. No toxicity for MT-4 cells was observed at concentrations up to 400 micrograms/ml. In addition, the agent inhibited the focus formation in HT4-6C cells (CD4-positive HeLa cells); the concentration for 50% focus reduction was 0.9 microgram/ml. HIV-1-induced cell fusion in cocultures of MOLT-4 cells and MOLT-4/HTLV-IIIB were also blocked by complestatin (the concentration for 50% cell fusion inhibition, 0.9 microgram/ml). Complestatin had no ability to inhibit HIV-1 reverse transcriptase activity. When MT-4 cells were pretreated with complestatin for 2 hrs prior to the exposure to HIV-1, the HIV-1-induced cytopathicity was markedly inhibited, while pretreatment of HIV-1 with the agent did not affect the infection. These results suggest that complestatin primarily interacts with cells and inhibits viral adsorption to the cell surface as well as adsorption of infected cells to adjacent cells.

Amino Acids↗
PubMed1991

High-performance liquid chromatographic separation of bile acid pyrenacyl esters with cyclodextrin-containing mobile phase.

The high-performance liquid chromatographic separation of bile acid pyrenacyl esters with cyclodextrin-containing mobile phase is presented. Compared with conventional methods, inclusion chromatography gives much more satisfactory separation of derivatized bile acids in a short time. The application of this method to the separation of glycine-conjugated bile acids in human bile is also described.

Bile Acids and Salts↗
PubMed1991

Quantitative estimation of human immunodeficiency virus type-1 provirus in CD4+ T lymphocytes using the polymerase chain reaction.

The proviral burden of peripheral blood lymphocytes in 29 patients infected with human immunodeficiency virus type-1 (HIV-1) was estimated using a polymerase chain reaction method which we recently refined. The mean numbers of HIV-1 provirus in eight patients with AIDS and AIDS-related complex treated with zidovudine (AZT), in 10 asymptomatic patients treated with AZT, and in 11 asymptomatic untreated patients were 892, 436, and 406 copies in 1 x 10(5) CD4- T lymphocytes, respectively. These results demonstrate that patients may have more HIV-1 provirus copies in an advanced than early stage of disease, and that the fraction of the infected lymphocytes is much higher than previously thought, especially in asymptomatic patients. There was no difference in the viral burden in CD4+ T lymphocytes regardless of whether AZT had been administered or not. These findings validate the method used here to quantitate HIV-1 provirus DNA and confirm that AZT is not effective in reducing the amount of provirus DNA in lymphocytes.

AIDS-Related Complex↗
PubMed1991

Immune response of mice infected with recombinant vaccinia viruses carrying the HIV gag gene.

We examined mouse immune response to 4 kinds of recombinant vaccinia viruses carrying the HIV gag gene, including vac-gag/pol, which produces HIV-like particles with processed gag proteins; vac-gag, which also produces HIV-like particles but with unprocessed gag protein; and vac-gag-pol-fuse and vac-es-gag/pol, neither of which produces such particles but releases reverse transcriptase and gag protein, respectively, from infected cells. Although infection of mice with recombinant vaccinia viruses induced production of the anti-p24 antibody in all mice, vac-gag/pol and vac-es-pol induced higher production than the other two recombinants. Increase in [3H]thymidine uptake by splenic lymphocytes following p24 antigen stimulation was most evident in mice infected with vac-gag/pol. Thus, the highest immune reaction, both humoral and cellular, was elicited by vac-gag/pol, indicating that among those tested, this recombinant vaccinia virus is the best candidate for a vaccine that induces anti-HIV gag immunity.

Animals↗
PubMed1991

Impaired tumour necrosis factor-alpha (TNF-alpha) production and abnormal B cell response to TNF-alpha in patients with systemic lupus erythematosus (SLE).

We examined the TNF-alpha activity in culture supernatants of monocytes isolated from the peripheral blood of patients with SLE and of normal individuals. The monocytes from patients with SLE stimulated with silica particles, lipopolysaccharide or Staphylococcus aureus Cowan 1 secreted significantly lower amounts of TNF-alpha than did normal monocytes. A decreased TNF mRNA expression was observed in peripheral blood mononuclear cells stimulated by mitogens from patients with SLE. Furthermore, we examined the effect of recombinant TNF-alpha (rTNF-alpha) on the B cell function in SLE patients. rTNF-alpha inhibited the spontaneous B cell proliferation of SLE, but tended to enhance the normal B cell proliferation. Spontaneous IgM production from SLE B cells was inhibited by rTNF-alpha, but that from normal B cells was not. Spontaneous IgG production was unaffected by rTNF-alpha. Also, rTNF-alpha did not affect the viability of B cells. These findings suggest that an impaired TNF-alpha production and an abnormal B cell response to TNF-alpha play a role in the immunological dysfunction in patients with SLE.

B-Lymphocytes↗
PubMed1991

[A case of human-immunodeficiency virus infection related Mycobacterium tuberculosis with atypical clinical features].

Increasing rates of human immunodeficiency virus (HIV) related tuberculosis have been noted and recently the clinical importance of the disease has been mentioned. The diagnosis of tuberculosis is more difficult in those patients with HIV seropositive than those with seronegative, because those with seropositive have atypical clinical features. A 29-year-old male, who was infected with HIV heterosexually in Central Africa in 1986, was admitted to our hospital with a history of general malaise and weight loss in April, 1989. Laboratory and physical examinations revealed anemia, thrombocytopenia, the elevation of LDH, and giant intraabdominal lymphadenopathies, suspecting malignant lymphoma. Mycobacterium was isolated from the sputa in April and was confirmed as M. tuberculosis using a DNA probe in May, 1989. Clinical symptoms including giant lymphadenopathies and laboratory abnormalities improved with antituberculosis therapy. Development of a rapid method for the diagnosis of tuberculosis was warranted in this case.

AIDS-Related Complex↗
PubMed1991

Correlations between IL-2 enhancing activity and clinical parameters in patients with rheumatoid arthritis and systemic lupus erythematosus.

In a previous paper (Tomura, K. et al. Tohoku J. Exp. Med., 1989, 159, 171-183), we discovered IL-2 enhancing factor(s) designated B cell derived-growth enhancing factor-2 (BGEF-2), which enhanced IL-2 dependent cell proliferation, and reported that BGEF-2 was produced by B cells of the patients with rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE) only when they were in the active stage of the disease. In this paper, we studied relationship between each IL-2 enhancing activity from B cell supernatant of the patients with these diseases and clinical parameters. IL-2 enhancing activities did not correlate with erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP), but correlated with plasma concentrations of gamma-globulin from the patients with RA and SLE in the active stages. IL-2 enhancing activities correlated with hypocomplementemia and leukocytopenia in the patients with SLE, and also correlated with RAHA titer in the patients with RA. Moreover, on several patients with RA or SLE in the active stages, diminution of IL-2 enhancing activity was found when they were in the remission stage after treatments. These findings suggested that IL-2 enhancing activity (i.e., BGEF-2 activity) correlated with activity of these diseases and supported the hypothesis that BGEF-2 played an important role in the polyclonal B cell activation and autoantibody production in patients with these diseases.

Adult↗
PubMed1991

Deletions and rearrangements of the retinoblastoma gene in hepatocellular carcinoma, insulinoma and some neurogenic tumors as found in a study of 121 tumors.

The retinoblastoma gene (Rb) is one of the tumor suppressor genes to have already been cloned. Deletions and inactivations of the gene have been widely observed in various types of human tumor. To study the generality of Rb alteration in human tumors, 121 cases of tumor DNAs were examined for abnormalities in the gene structure by blot hybridization. Deletions of both alleles were detected in hepatocellular carcinoma, insulinoma and neuroblastoma. Rearrangements and allelic deletions of the Rb gene were, moreover, observed in some brain tumors and hepatocellular carcinomas, respectively. All were surgically resected tumors. The observations suggest the inactivation of Rb through structural alterations sometimes to correlated with the development or progression of these types of human tumor.

Blotting, Southern↗
PubMed1991

Epidemiology of HDV infection in Japan.

Anti-HD antibody was not detected in 342 patients with acute type B hepatitis including 8 patients with fulminant hepatitis. Anti-HD antibody was detected in 10 out of 1668 HBV carriers. The overall prevalence was 0.59 percent. Two (0.34%) out of 586 ASC, 3 (0.43%) out of 690 patients with CH and 5 (1.47%) out of 338 patients with LC were positive for anti-HD antibody. No anti-HD antibody was detected in sera of 54 patients with HCC. The prevalence of anti-HD antibody was relatively high in patients with LC, however, HDV infection was relatively rare in Japan and it does not always play a major role in progression of liver disease. The prevalence of HDV infection in HBV carriers has not changed in Japan during the last ten years (1.3% vs. 1.49%).

Acute Disease↗
PubMed1990

Quantitative analysis of human immunodeficiency virus type-1 DNA in asymptomatic carriers using the polymerase chain reaction.

A method for detecting human immunodeficiency virus type 1 (HIV-1) provirus DNA in lymphocytes with improved sensitivity and reproducibility was developed using the polymerase chain reaction (PCR). Amplified HIV-1 DNA was hybridized with a 32P-labeled probe and quantitated with a beta-scanner after electrophoresis. A linear relationship was obtained between the common logarithms of the counts detected and the number of HIV-1 DNA copies applied to the PCR. Detectability was from 3 copies/10(5) lymphocytes, and linearity was maintained from 10 to 10(3) copies. HIV-1 DNA was detected in all 9 asymptomatic carriers tested (18 to 2,857 copies/10(5) CD4+ T lymphocytes). The viral burden was inversely related to the CD4+ lymphocyte count, suggesting that quantitation of provirus levels may serve as a predictor of progress in early HIV infection.

Autoradiography↗
PubMed1990

Retention behavior of bile acid derivatives using cyclodextrin in the mobile phase in high-performance liquid chromatography.

The retention behavior of 3-(1-anthroyl)bile acids together with bile acid glucuronides, sulfates, and 12-dehydro derivatives is examined by the addition of cyclodextrin to the mobile phase in reversed-phase high-performance liquid chromatography. The data suggest that the functional group at the 12 position of the steroid moiety may be the important factor for the formation of the inclusion complex from the solute and cyclodextrin. The separation of these bile acid derivatives is much improved by this inclusion chromatography.

Bile Acids and Salts↗