Search PubMed⌕ Search

Biomedical subjects

K J McConnell

Publications and source records attributed to K J McConnell.

5 recordsLinked to original sources

Molecular dynamics simulations of B '-DNA: sequence effects on A-tract-induced bending and flexibility.

Molecular dynamics (MD) simulations including water and counterions are reported on five examples of A-tract DNA oligonucleotide dodecamer duplexes for which crystal structures are available, the homopolymeric duplex sequences poly(dA) and poly(dG), and two related sequences that serve as controls. MD was performed using the AMBER suite of programs for 3 ns on each sequence. These results, combined with previously reported MDs on 25-mer and 30-mer oligonucleotides on sequences with phased A-tracts carried out under a similar simulation protocol, are used to examine salient issues in the structural chemistry of ApA steps and A-tract induced axis bending. MD modeling successfully describes the distinctive B' structure of A-tracts in solution as essentially straight (wedge angles of <1 degrees ), more rigid than generic B-form DNA, with slight base-pair inclination, high propeller twist and a minor groove narrowing 5' to 3'. The MD structures in solution agree closely with corresponding crystal structures, supporting the idea that crystal structures provide a good model for A-tract DNA structure in solution. From the collective MD results, bending and flexibility are calculated by step. Pyrimidine-purine steps are predicted to be most intrinsically bent and also most bendable, i.e. susceptible to bending. Pyrimidine-pyrimidine ( approximately purine-purine) and purine-pyrimidine steps show less intrinsic deformation and deformability. The MD calculated flexibility correlates well with the protein-induced bendability derived independently from the protein DNA crystal structures. The MD results indicate that bending and flexibility of base-pair steps in DNA are highly correlated, i.e. steps that exhibit the most intrinsic deformation from B-form DNA turn are also the most dynamically deformable. The MD description of A-tract-induced axis bending shows most consistency with the non A-tract, general-sequence model, in which the sequence curvature originates primarily in base-pair roll towards the major groove in non-A-tract regions of the sequence, particularly pyrimidine-purine steps. The direction of curvature is towards the minor groove viewed from opposite the A-tracts, but the A-tracts per se exhibit only minor deformation. The MD results are found to be consistent with the directionality of bending inferred for DNA sequences from gel retardation and cyclization experiments.

Base Pairing↗

Molecular dynamics simulation reveals sequence-intrinsic and protein-induced geometrical features of the OL1 DNA operator.

We have carried out molecular dynamics simulation of the lambda OL1 DNA operator on the free and the protein-bound forms. Our results lead us to conclude that the binding of the repressor actually makes the N-7 atom of Gua8' more solvent exposed, thereby enhancing its reactivity to chemical methylation. This increase in solvent accessibility surface area occurs simultaneously with the formation of hydrogen bonds between Lys-4 of the nonconsensus flexible N-terminal arm and Gua6' of the nonconsensus half-site operator DNA. Calculations of protein--DNA interaction energies reveal that among the residues of the arm, Lys-4 contributes the most favorably to the interaction energies. This result is consistent with mutagenesis studies that established that lysine at position 4 is absolutely required for tight binding. We find that the nonconsensus arm and the nonconsensus monomer interacts less favorably with DNA than do their respective counterparts of the consensus monomer. Moreover, the six-residue flexible arm accounts for at least half the total protein--DNA interactions energy. These results are in agreement with previous experimental studies. In accord with the diffuse electron density map observed in crystallographic studies of the nonconsensus flexible arm, we find that our model built for this region is more flexible and exhibits more conformations than its consensus counterpart. The simulation also reveals that DNA bending observed near the outer edge of the operator site is an intrinsic sequence-dependent property. By contrast, the DNA-bending features observed toward the center of the operator are induced by the protein. On the whole, stepwise protein-induced bending is more pronounced in the consensus half-site operator. We also find that the unusually large helical twist (49 degrees ) observed in the protein-bound form near the center of the operator results from the binding of the protein at a base step with some propensity for high twists.

Bacteriophage lambda↗

Molecular dynamics and thermodynamics of protein-RNA interactions: mutation of a conserved aromatic residue modifies stacking interactions and structural adaptation in the U1A-stem loop 2 RNA complex.

Molecular dynamics (MD) simulations and free energy component analysis have been performed to evaluate the molecular origins of the 5.5 kcal/mol destabilization of the complex formed between the N-terminal RNP domain of U1A and stem loop 2 of U1 snRNA upon mutation of a conserved aromatic residue, Phe56, to Ala. MD simulations, including counterions and water, have been carried out on the wild type and Phe56Ala peptide-stem loop 2 RNA complexes, the free wild type and Phe56Ala peptides, and the free stem loop 2 RNA. The MD structure of the Phe56Ala-stem loop 2 complex is similar to that of the wild type complex except the stacking interaction between Phe56 and A6 of stem loop 2 is absent and loop 3 of the peptide is more dynamic. However, the MD simulations predict large changes in the structure and dynamics of helix C and increased dynamic range of loop 3 for the free Phe56Ala peptide compared to the wild type peptide. Since helix C and loop 3 are highly variable regions of RNP domains, this indicates that a significant contribution to the reduced affinity of the Phe56Ala peptide for RNA results from cooperation between highly conserved and highly variable regions of the RNP domain of U1A. Surprisingly, these structural effects, which are manifested as cooperative free energy changes, occur in the free peptide, rather than in the complex, and are revealed only by study of both the initial and final states of the complexation process. Free energy component analysis correctly accounts for the destabilization of the Phe56Ala-stem loop 2 complex, and indicates that approximately 80% of the destabilization is due to the loss of the stacking interaction and approximately 20% is due to differences in U1A adaptation.

Mutation↗

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.

Base Pairing↗

Nucleic acids: theory and computer simulation, Y2K.

Molecular dynamics simulations on DNA and RNA that include solvent are now being performed under realistic environmental conditions of water activity and salt. Improvements to force-fields and treatments of long-range interactions have significantly increased the reliability of simulations. New studies of sequence effects, axis bending, solvation and conformational transitions have appeared.

Chemical Phenomena↗