Diagnosis of irritable bowel syndrome.
Explore the source record for details and available documents.
Adult↗
Biomedical subjects
K H Johnson
Publications and source records attributed to K H Johnson.
Cholesterol-lowering agent in men without CHD.
Explore the source record for details and available documents.
Adult↗
Oral contraceptives and breast cancer.
Explore the source record for details and available documents.
Adult↗
Absorption and circular dichroism spectroscopy of nucleic acid duplexes and triplexes.
Absorption and CD measurements of complementary oligomers and mixtures are described. The concentrations of oligomers may be estimated from absorption measurements and nearest-neighbor calculations of molar extinction coefficients. Interactions between complementary strands in mixtures can lead to obvious differences between measured CD spectra and the average of the spectra of the individual strands. CD spectra also allow an assessment of whether the individual strands are in self-complexes, which could compete with duplex or triplex formation. Isodichroic and isoabsorptive points provide important indicators of the stoichiometry of the strands in base-paired complexes. CD spectra provide an important means of characterizing differences in the conformations of DNA, RNA, and hybrid duplexes or triplexes having analogous sequences.
Circular Dichroism↗
Diabetes mellitus associated with pancreatic endocrine insufficiency in a kitten.
Diabetes mellitus, characterised by persistent hyperglycaemia and glucosuria, was diagnosed in a six-week-old kitten. Pancreatic sections contained low numbers of atypically small islets and immunohistochemistry demonstrated pancreatic endocrine insufficiency with virtually no production of any islet hormones. There was no inflammatory infiltration of the islets, as seen in the form of diabetes mellitus characteristic of juvenile humans.
Amyloid↗
The age related amyloids: a growing family of unique biochemical substances.
Explore the source record for details and available documents.
Aged↗
Assignment of islet amyloid polypeptide (IAPP) gene to feline chromosome B4 using the polymerase chain reaction technique on feline-rodent hybrid cell lines.
The most characteristic morphologic features of the pancreatic islets of human non-insulin-dependent diabetes mellitus (NIDDM, or type 2 diabetes mellitus) and of similar forms of diabetes in cats and macaques are the deposition of amyloid (islet amyloid) and the loss of beta cells. Islet amyloid is derived from islet amyloid polypeptide (IAPP), which is a normal secretory product of the beta cells. Therefore, knowledge of the IAPP gene is of potential importance in defining the pathogenesis of NIDDM. To identify the feline chromosome(s) on which the IAPP gene is located, we screened genomic DNA obtained from 38 feline-rodent hybrid cell lines that have a known feline chromosome content. Feline IAPP DNA was amplified and detected using the polymerase chain reaction technique. Discordancy analysis for each feline chromosome showed that chromosome B4 had the lowest discordancy (P < 0.0001). Feline chromosome B4 shows an extensive conserved syntenic relationship with human chromosome 12, on which the human IAPP gene is located. This study therefore extends and confirms the homology between human chromosome 12 and feline chromosome B4 and provides an additional genetic marker for feline chromosome B4.
Amyloid↗
Apolipoprotein A1-derived amyloid in human aortic atherosclerotic plaques.
Amyloid deposits in the aortic intima are very common in association with atherosclerosis and aging. In the present study, a major fibril protein purified from amyloid present in human atherosclerotic plaques was shown to be a 69-amino acid N-terminal fragment of apolipoprotein AI. Although senile form of localized apolipoprotein AI-derived amyloidosis has recently been documented in pulmonary vessels of dogs, this is the first example of a localized human amyloid derived from this apolipoprotein.
Aged↗
Apolipoprotein AI-derived pulmonary vascular amyloid in aged dogs.
Our studies confirm the common occurrence of a unique form of apolipoprotein AI (apoAI)-derived vascular amyloidosis in dogs that appears to be unrelated to other disease conditions, but is associated with aging. Vascular amyloid deposits were most frequently located within the intima and media of medium-sized pulmonary arteries, and were not confirmed in any other tissues. Pulmonary vascular amyloid immunoreactive with antiserum to purified N-terminal (1-71) canine apoAI amyloid protein was demonstrated retrospectively in 12.8% of necropsied dogs (N = 243) 10 years of age or older. In a subsequent expanded 1-year prospective study of necropsied dogs (N = 231) of all ages, apoAI-derived pulmonary vascular amyloid deposits were demonstrated in 0.7% of dogs < 10 years of age and in 22% of dogs 10 years of age or older. The incidence of this form of amyloid in dogs 10 years of age or older was significantly associated with advancing age (P < 0.00001). However, significant differences regarding gender, breed, or the frequency of selected common disease conditions were not observed when the dogs with apoAI-derived amyloid were compared with control dogs. The possibility that this new form of senile apoAI-derived amyloidosis is a manifestation of an age-associated aberration in apoAI metabolism or is related to a mutant form of apoAI is the subject of ongoing investigations.
Aging↗
Islet amyloid polypeptide in human insulinomas. Evidence for intracellular amyloidogenesis.
Amyloid deposits that characteristically form in the pancreatic islets of patients with non-insulin-dependent diabetes mellitus (NIDDM) and in insulinomas are both derived from islet amyloid polypeptide (IAPP). Evidence from previous studies has suggested that deposition of IAPP-derived amyloid is related to inherent amyloidogenic sequences present within normal human IAPP, together with an increased production and local concentration of IAPP. However, whether the aggregation of IAPP to form amyloid fibrils is primarily an intra- or extracellular event is not clear. To address this question, we studied 20 human insulinomas by light and electron microscopy. By light microscopy, amyloid deposits were demonstrated in 13 of 20 (65%) human insulinomas. Furthermore, evaluation of Congo red-stained tumor sections showed small, globular or irregular, congophilic amyloid deposits within the cytoplasm of many tumor cells in 10 of 13 (77%) amyloid-containing insulinomas. Dense, punctate areas of IAPP immunoreactivity within tumor cells corresponded with the congophilic intracellular deposits. Ubiquitin immunoreactivity also was observed as punctate intracellular labeling and within large extracellular amyloid deposits. Among the 10 insulinomas available for electron microscopic evaluation, pathological IAPP-immunoreactive (immunogold) deposits were found in 3 of 5 insulinomas in which amyloid was demonstrated by light microscopy and in none of 5 tumors found negative for amyloid by light microscopy. Morphology of IAPP-immunoreactive deposits varied from those with the classical distinct 7- to 10-nm diameter nonbranching fibrils to those with distinct but faint fibrillarity to those without discernable fibrils.(ABSTRACT TRUNCATED AT 250 WORDS)
Adult↗
Islet amyloid polypeptide in the rabbit and European hare: studies on its relationship to amyloidogenesis.
In this study, we determined the cDNA-predicted amino acid sequence of positions 9-31 of islet amyloid polypeptide from the rabbit and European hare. A synthetic rabbit/hare islet amyloid polypeptide 20-29 peptide was subsequently shown to be strongly fibrillogenic in vitro even though the putative amyloidogenic AILS sequence at positions 25-28 of human and cat islet amyloid polypeptide is modified in the rabbit and hare by a substitution of phenylalanine for leucine at position 27 (i.e. AIFS). Although islet amyloid polypeptide of both the rabbit and hare has an amyloidogenic sequence and is in fact amyloidogenic in vitro, the apparent lack of in vivo islet amyloidosis in rabbits and hares may be related to relatively low levels of islet amyloid polypeptide production by the islet beta cells in these species. This was supported by our findings that there is no substantial immunoreactivity in either rabbit or hare islets, and no measurable amount either in extracts of rabbit pancreases, or in rabbit plasma. This study supports the need for at least two prerequisites for the development of islet amyloidosis in vivo: an inherent fibrillogenic sequence within the islet amyloid polypeptide molecule and an adequate local concentration of islet amyloid polypeptide to promote self aggregation and formation of islet amyloid.
Amino Acid Sequence↗
Islet amyloid polypeptide: a review of its biology and potential roles in the pathogenesis of diabetes mellitus.
Islet amyloidosis (IA) is the principal lesion in the endocrine pancreas of human beings with non-insulin-dependent diabetes mellitus (NIDDM) and in the similar forms of diabetes mellitus in domestic cats and macaques. As such, the delineation of the pathogenesis of this form of amyloidosis may be crucial to the understanding of the development and progression of NIDDM. Islet amyloid polypeptide (IAPP) is a recently discovered polypeptide that is the principal constituent of IA in human beings, cats, and macaques. IAPP is produced by the pancreatic beta-cells and is co-packaged with insulin in the beta-cell secretory vesicles. Immunohistochemical and physiologic evidence supports the notion that the beta-cells are heterogenous with respect to their relative contents of insulin and IAPP. Therefore, although IAPP is co-secreted with insulin in response to a variety of well-known insulin secretagogues, the molar ratio of these two proteins that is released from the islets may vary, depending upon the glucose concentration and prevailing metabolic milieu. IAPP is highly conserved among mammalian species and has about 45% homology to another neuropeptide, calcitonin gene-related peptide. IAPP is encoded by a single-copy gene located, in the human being, on chromosome 12. IAPP is expressed as a 93 (murine)-89 (human)-amino acid prepropolypeptide that is processed enzymatically, resulting in the removal of amino- and carboxy-terminal propeptide segments. The 20-29 region of the IAPP molecule is most important in the ability of IAPP to form amyloid fibrils. The role of IAPP and IA in the pathogenesis of human NIDDM and similar forms of diabetes mellitus in cats and macaques may involve several possible mechanisms, including 1) direct physical/chemical damage to beta-cells, resulting in necrosis and loss of functional islet tissue, 2) biologic activities of IAPP that oppose those of insulin or abnormally suppress insulin secretion, and 3) interference by IA deposits of passage of insulin out of beta-cells and/or entrance of glucose and other secretogogues into the islet. The roles of each of these possible mechanisms have yet to be demonstrated. In addition, the physiological significance of the apparent IAPP deficiency in both insulin-dependent diabetes mellitus and NIDDM is currently unknown.
Amino Acid Sequence↗
The vacuum UV CD spectra of G.G.C triplexes.
Vacuum UV circular dichroism (CD) spectra were measured down to 175 nm for d(C)10, d(G)10, the d(G)10.d(C)10 duplex, and the d(G)10.d(G)10.d(C)10 triplex. A CD difference spectrum was calculated for d(G)10.d(C)10 giving the change in CD induced by forming the duplex from d(G)10 and d(C)10. The d(G)10.d(G)10.d(C)10 CD difference spectrum gave the CD induced by triplex formation from binding of d(G)10 to the d(G)10.d(C)10 duplex. In the near-UV, the d(G)10.d(C)10 and d(G)10.d(G)10.d(C)10 difference spectra resembled the difference spectrum for poly[r(G).r(C)] (Biopolymers 29, 325-333). This similarity may be an indication of similar purine base stacking. The d(G)10.d(G)10.d(C)10 vacuum UV difference spectrum had a negative band at 195 nm and a positive band at 180 nm, making it similar to difference spectra for homopolymer triplexes containing T.A.T and U.A.U triplets (Nucl. Acids Res. 19, 2275-2280). The appearance of these bands in difference spectra should be good indicators of triplex formation. The complementary oligonucleotides c-mycI d(CCCCACCCTCCC) and c-mycII d(GGGAGGGTGGGG) are part of the regulatory sequences of the human c-myc gene. G.G.C rich triplexes formed by binding c-mycII or c-mycIII d(GGGGTGGGTGGG) to the c-mycI.c-mycII duplex had CD difference spectra similar to that of d(G)10.d(G)10.d(C)10 in both the vacuum UV and near UV regions, indicating similar triplet structures.
Base Sequence↗
Human islet amyloid polypeptide at pharmacological levels inhibits insulin and phorbol ester-stimulated glucose transport in in vitro incubated human muscle strips.
Human islet amyloid polypeptide, at concentrations of 1-100 nmol/l, has been demonstrated to inhibit the insulin-stimulated increase in rat muscle glycogen content. However, at physiological concentrations (1-10 pmol/l) of islet amyloid polypeptide, no effects have been reported. We tested the effect of a wide range of concentrations of human islet amyloid polypeptide on insulin- and phorbol ester-stimulated 3-0-methylglucose transport in in vitro incubated human skeletal muscle. Muscle specimens from the quadriceps femoris muscle were obtained from 23 healthy subjects with the use of a newly-developed open muscle biopsy technique. Human islet amyloid polypeptide at a concentration of 100 nmol/l had no effect on basal glucose transport, but inhibited the stimulatory effect of a maximal insulin concentration (1000 microU/ml) by 69% (p less than 0.001). The presence of human islet amyloid polypeptide at 1, 10 and 100 nmol/l decreased the effect of 100 microU/ml of insulin on glucose transport by 61% (p less than 0.05), 78% (p less than 0.05) and 76% (p less than 0.05), respectively. Similarly, human islet amyloid polypeptide at a concentration of 10 nmol/l inhibited phorbol ester-stimulated glucose transport by 100% (p less than 0.05). The inhibitory effects of human islet amyloid polypeptide on glucose transport were present in the muscle strips despite no net changes in glycogen content. Human islet amyloid polypeptide at 10 and 100 pmol/l had no effect on the rate of insulin-stimulated glucose transport.(ABSTRACT TRUNCATED AT 250 WORDS)
3-O-Methylglucose↗
Islet amyloid polypeptide--a novel controversy in diabetes research.
Explore the source record for details and available documents.
Amino Acid Sequence↗
Analysis of an RNA pseudoknot structure by CD spectroscopy.
The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.
Base Composition↗
The complete amino acid sequence of bovine serum amyloid protein A (SAA) and of subspecies of the tissue-deposited amyloid fibril protein A.
Bovine serum amyloid A (SAA) was isolated from the acute phase high density lipoprotein (HDL) fraction of a cow suffering from acute mastitis. The elucidated primary structure revealed a protein consisting of 112 amino acid residues. Compared with SAA proteins from other species, the bovine protein was shown to have an insertion of nine amino acid residues between positions 69 and 70. No microheterogeneity could be observed in the protein. Amyloid fibrils extracted from the kidneys were found to contain at least three subspecies of protein AA, consisting of 68, 81 and about 110 amino acid residues. The amino acid sequences established for the protein AA subspecies revealed no microheterogeneity, and were identical to that elucidated for protein SAA.
Amino Acid Sequence↗
Pulmonary vascular amyloidosis in aged dogs. A new form of spontaneously occurring amyloidosis derived from apolipoprotein AI.
The N-terminus of a mutant form of apolipoprotein AI [apoAI] has previously been shown to be the subunit protein of amyloid fibrils in a human kindred with a form of familial amyloid polyneuropathy (FAP, type III) and in a recently reported kindred with a form of non-neuropathic hereditary amyloidosis. In this study, we demonstrate by amino-acid sequence analysis, that a form of vascular amyloidosis occurring in the lungs of aged dogs is derived from a N-terminal fragment of apoAI and that no amino acid substitution is present in this confirmed sequence. This represents the first documentation of apoAI as a precursor for a form of amyloidosis in animals, and provides the first documentation of apoAI as a precursor for amyloid fibrils in a form of age-associated ("senile") amyloidosis. Secondary structure prediction analysis of the N-terminal regions of normal human and dog apoAI indicated a propensity for beta-pleated sheet conformation, and thus amyloidogenesis, in 40 and 45% of the respective sequences. These results suggest that apoAI (like transthyretin) may serve as an amyloid precursor protein for both familial and senile forms of amyloidosis. ApoAI should, therefore, be considered as a potential amyloid precursor when forms of human senile amyloidosis of unknown origin are evaluated.
Aging↗