Search PubMed⌕ Search

Biomedical subjects

K H Choo

Publications and source records attributed to K H Choo.

At least 19 recordsLinked to original sources

Mosaic inv dup(8p) marker chromosome with stable neocentromere suggests neocentromerization is a post-zygotic event.

Marker chromosomes containing active human neocentromeres have been described in individuals where the chromosomes are non-mosaic, suggesting that they are mitotically stable, but also in individuals where there is mosaicism, raising the possibility of neocentromere instability. We report two independently ascertained individuals who are mosaic for a supernumerary marker chromosome, shown by reverse chromosome painting to have an 8p origin, resulting in mosaicism for tetrasomy 8p23.1-->pter in the patient. The markers have a primary constriction but show no detectable centromeric alpha-satellite DNA. The marker in Patient 1 demonstrated no centromere protein CENP-B binding, but associated with nine different functionally critical centromere proteins. Investigation of peripheral blood lymphocytes from this patient on five separate occasions over a 13-year period showed 23-46% mosaicism for the marker chromosome with no decrease in incidence. In vitro investigation of primary and secondary sub-clones of a lymphoblast cell line derived from the patient demonstrated 100% stability of the marker chromosome indicating that neocentromere instability is unlikely to be responsible for the mosaicism in the patient. This and other available data support a general model of neocentromerization as a post-zygotic event, irrespective of whether the supernumerary chromosome fragment has arisen during meiosis or post-fertilization at mitosis.

Adolescent↗

Construction of neocentromere-based human minichromosomes by telomere-associated chromosomal truncation.

Neocentromeres (NCs) are fully functional centromeres that arise ectopically in noncentromeric regions lacking alpha-satellite DNA. Using telomere-associated chromosome truncation, we have produced a series of minichromosomes (MiCs) from a mardel(10) marker chromosome containing a previously characterized human NC. These MiCs range in size from approximately 0.7 to 1.8 Mb and contain single-copy intact genomic DNA from the 10q25 region. Two of these NC-based Mi-Cs (NC-MiCs) appear circular whereas one is linear. All demonstrate stability in both structure and mitotic transmission in the absence of drug selection. Presence of a functional NC is shown by binding a host of key centromere-associated proteins. These NC-MiCs provide direct evidence for mitotic segregation function of the NC DNA and represent examples of stable mammalian MiCs lacking centromeric repeats.

Cell Line↗

A 330 kb CENP-A binding domain and altered replication timing at a human neocentromere.

Centromere protein A (CENP-A) is an essential centromere-specific histone H3 homologue. Using combined chromatin immunoprecipitation and DNA array analysis, we have defined a 330 kb CENP-A binding domain of a 10q25.3 neocentromere found on the human marker chromosome mardel(10). This domain is situated adjacent to the 80 kb region identified previously as the neocentromere site through lower-resolution immunofluorescence/FISH analysis of metaphase chromosomes. The 330 kb CENP-A binding domain shows a depletion of histone H3, providing evidence for the replacement of histone H3 by CENP-A within centromere-specific nucleosomes. The DNA within this domain has a high AT-content comparable to that of alpha-satellite, a high prevalence of LINEs and tandem repeats, and fewer SINEs and potential genes than the surrounding region. FISH analysis indicates that the normal 10q25.3 genomic region replicates around mid-S phase. Neocentromere formation is accompanied by a replication time lag around but not within the CENP-A binding region, with this lag being significantly more prominent to one side. The availability of fully sequenced genomic markers makes human neocentromeres a powerful model for dissecting the functional domains of complex higher eukaryotic centromeres.

Autoantigens↗

Engineering human chromosomes for gene therapy studies.

We now have the capability to engineer human chromosomes that could be used to deliver therapeutic genes in gene therapy studies. These vectors have the advantages of being non-disruptive to the genome, non-immunogenic and are capable of carrying very large genes with all their regulatory sequences. What challenges lie ahead, and what future does this technology hold for gene therapy?

Animals↗

Domain organization at the centromere and neocentromere.

Recent data indicate that the eukaryotic centromere and pericentromeric regions are organized into definable functional and structural domains. Studies in different organisms point to a model of conserved pattern of organization for these domains.

Animals↗

Identification and characterization of satellite III subfamilies to the acrocentric chromosomes.

The centromeres and the short arms of the five pairs of acrocentric chromosomes in humans are composed of tandemly ordered repetitive DNA. Previous studies have suggested that the exchanges between acrocentric chromosomes have resulted in concerted evolution of different DNA sequences in their short arms. The acrocentric chromosomes are clinically relevant since they are involved in Robertsonian translocation formation and non-disjunction resulting in aneuploidy. Here we have identified seven new satellite III repetitive DNA subfamilies, determined their nucleotide sequences and established their chromosomal distributions on the short arms of the acrocentric chromosomes. Knowledge of these related sequences may help to elucidate the molecular basis of Robertsonian translocation formation.

Base Sequence↗

Satellite III sequences on 14p and their relevance to Robertsonian translocation formation.

Robertsonian translocations (ROBs) are the most common rearrangements in humans, contributing significantly to genetic imbalance, fetal wastage, mental retardation and birth defects. Rob(14q21q) and rob(13q14q), which are formed predominantly during female meiosis, comprise the majority (approximately 85%) of all ROBs. Previous studies have shown that the breakpoints are consistently located within specific regions of the proximal short arms of chromosomes 13, 14, and 21. The high prevalence of these translocations, the consistent breakpoints found, and the fact that roughly 50% of cases occur sporadically suggest that the sequences at or near the breakpoints confer susceptibility to chromosome rearrangement and that the rearrangements occur through a specific mechanism. To investigate this hypothesis, we developed hamster-human somatic cell hybrids derived from de novo rob(14q21q) patients that contained the translocated chromosome segregated from the other acrocentric chromosomes. We determined the physical order of five satellite III subfamilies on 14p, and investigated their involvement in formation of these de novo translocations.

Abnormalities, Multiple↗

A novel chromatin immunoprecipitation and array (CIA) analysis identifies a 460-kb CENP-A-binding neocentromere DNA.

Centromere protein A (CENP-A) is an essential histone H3-related protein that constitutes the specialized chromatin of an active centromere. It has been suggested that this protein plays a key role in the epigenetic marking and transformation of noncentromeric genomic DNA into functional neocentromeres. Neocentromeres have been identified on more than two-thirds of the human chromosomes, presumably involving different noncentromeric DNA sequences, but it is unclear whether some generalized sequence properties account for these neocentromeric sites. Using a novel method combining chromatin immunoprecipitation and genomic array hybridization, we have identified a 460-kb CENP-A-binding DNA domain of a neocentromere derived from the 20p12 region of an invdup (20p) human marker chromosome. Detailed sequence analysis indicates that this domain contains no centromeric alpha-satellite, classical satellites, or other known pericentric repetitive sequence motifs. Putative gene loci are detected, suggesting that their presence does not preclude neocentromere formation. The sequence is not significantly different from surrounding non-CENP-A-binding DNA in terms of the prevalence of various interspersed repeats and binding sites for DNA-interacting proteins (Topoisomerase II and High-Mobility-Group protein I). Notable variations include a higher AT content similar to that seen in human alpha-satellite DNA and a reduced prevalence of long terminal repeats (LTRs), short interspersed repeats (SINEs), and Alus. The significance of these features in neocentromerization is discussed.

Alu Elements↗

Survivin and the inner centromere protein INCENP show similar cell-cycle localization and gene knockout phenotype.

BACKGROUND: Survivin is a mammalian protein that carries a motif typical of the inhibitor of apoptosis (IAP)proteins, first identified in baculoviruses. Although baculoviral IAP proteins regulate cell death, the yeast Survivin homolog Bir1 is involved in cell division. To determine the function of Survivin in mammals, we analyzed the pattern of localization of Survivin protein during the cell cycle, and deleted its gene by homologous recombination in mice. RESULTS: In human cells, Survivin appeared first on centromeres bound to a novel para-polar axis during prophase/metaphase, relocated to the spindle midzone during anaphase/telophase, and disappeared at the end of telophase. In the mouse, Survivin was required for mitosis during development. Null embryos showed disrupted microtubule formation, became polyploid, and failed to survive beyond 4.5days post coitum. This phenotype, and the cell-cycle localization of Survivin, resembled closely those of INCENP. Because the yeast homolog of INCENP, Sli15, regulates the Aurora kinase homolog Ipl1p, and the yeast Survivin homolog Bir1 binds to Ndc10p, a substrate of Ipl1p, yeast Survivin, INCENP and Aurora homologs function in concert during cell division. CONCLUSIONS: In vertebrates, Survivin and INCENP have related roles in mitosis, coordinating events such as microtubule organization, cleavage-furrow formation and cytokinesis. Like their yeast homologs Bir1 and Sli15, they may also act together with the Aurora kinase.

Amino Acid Sequence↗

Bub3 gene disruption in mice reveals essential mitotic spindle checkpoint function during early embryogenesis.

Bub3 is a conserved component of the mitotic spindle assembly complex. The protein is essential for early development in Bub3 gene-disrupted mice, evident from their failure to survive beyond day 6.5-7.5 postcoitus (pc). Bub3 null embryos appear normal up to day 3.5 pc but accumulate mitotic errors from days 4.5-6.5 pc in the form of micronuclei, chromatin bridging, lagging chromosomes, and irregular nuclear morphology. Null embryos treated with a spindle-depolymerising agent fail to arrest in metaphase and show an increase in mitotic disarray. The results confirm Bub3 as a component of the essential spindle checkpoint pathway that operates during early embryogenesis.

Animals↗

Early disruption of centromeric chromatin organization in centromere protein A (Cenpa) null mice.

Centromere protein A (Cenpa for mouse, CENP-A for other species) is a histone H3-like protein that is thought to be involved in the nucleosomal packaging of centromeric DNA. Using gene targeting, we have disrupted the mouse Cenpa gene and demonstrated that the gene is essential. Heterozygous mice are healthy and fertile whereas null mutants fail to survive beyond 6.5 days postconception. Affected embryos show severe mitotic problems, including micronuclei and macronuclei formation, nuclear bridging and blebbing, and chromatin fragmentation and hypercondensation. Immunofluorescence analysis of interphase cells at day 5.5 reveals complete Cenpa depletion, diffuse Cenpb foci, absence of discrete Cenpc signal on centromeres, and dispersion of Cenpb and Cenpc throughout the nucleus. These results suggest that Cenpa is essential for kinetochore targeting of Cenpc and plays an early role in organizing centromeric chromatin at interphase. The evidence is consistent with the proposal of a critical epigenetic function for CENP-A in marking a chromosomal region for centromere formation.

Animals↗

Human centromeres and neocentromeres show identical distribution patterns of >20 functionally important kinetochore-associated proteins.

Using combined immunofluorescence and fluorescence in situ hybridization (FISH) analysis we have extensively characterized the proteins associating with two different homologue human neocentromeres at interphase and prometaphase/metaphase, and compared these directly with those found with normal human centromeres. Antisera to CENP-A, CENP-B, CENP-C, CENP-E, CENP-F, INCENP, CLIP-170, dynein, dynactin subunits p150 (Glued) and Arp1, MCAK, Tsg24, p55CDC, HZW10, HBUB1, HBUBR1, BUB3, MAD2, ERK1, 3F3/2, topoisomerase II and a murine HP1 homologue, M31, were used in immuno-fluorescence experiments in conjunction with FISH employing specific DNA probes to clearly identify neocentromeric DNA. We found that except for the total absence of CENP-B binding, neocentromeres are indistinguishable from their alpha satellite-containing counterparts in terms of protein composition and distribution. This suggests that the DNA base of a potential centromeric locus is of minimal importance in determining the overall structure of a functional kinetochore and that, once seeded, the events leading to functional kinetochore formation occur independently of primary DNA sequence.

Anaphase↗

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Animals↗

Components of the human spindle checkpoint control mechanism localize specifically to the active centromere on dicentric chromosomes.

The spindle checkpoint control mechanism functions to ensure faithful chromosome segregation by delaying cell division until all chromosomes are correctly oriented on the mitotic spindle. Initially identified in budding yeast, several mammalian spindle checkpoint-associated proteins have recently been identified and partially characterized. These proteins associate with all active human centromeres, including neocentromeres, in the early stages of mitosis prior to the commencement of anaphase. We have examined the status of proteins associated with the checkpoint protein complex (BUB1, BUBR1, BUB3, MAD2), the anaphase-promoting complex (Tsg24, p55CDC), and other proteins associated with mitotic checkpoint control (ERK1, 3F3/2 epitope, hZW10), on a human dicentric chromosome. Each of these proteins was found to specifically associate with only the active centromere, suggesting that only active centromeres participate in the spindle checkpoint. This finding complements previous studies on multicentric chromosomes demonstrating specific association of structural and motor-related centromere proteins with active centromeres, and suggests that centromere inactivation is accompanied by loss of all functionally important centromere proteins.

Anaphase↗

Centromerization.

Centromere formation is a complex process that involves the packaging of DNA into a centromere-unique chromatin, chemical modification and the seeding of kinetochore and associated proteins. The early steps in this process, in which a chromosomal region is marked for centromerization (that is, to become resolutely committed to centromere formation), are unusual in that they can apparently occur in a DNA-sequence-independent manner. Current evidence indicates the involvement of epigenetic influences in these early steps. A number of epigenetic mechanisms that can affect centromere chromatin organization have been proposed. Here, the characteristics of these mechanisms and their relative roles as possible primary triggers for centromerization are discussed in the light of recent data.

Animals↗

Lack of metallothionein-I and -II exacerbates the immunosuppressive effect of ultraviolet B radiation and cis-urocanic acid in mice.

The effect of a null mutation for the metallothionein (MT)-I and -II isoforms in mice on the immunosuppressive action of ultraviolet B (UVB; 280-320 nm) radiation has been examined. Mice were exposed to a series of increasing daily UVB doses, each dose administered to the dorsum on 3 consecutive days. Erythema was assessed, and measured as its oedema component by the post-irradiation dorsal skinfold thickness, but there was no effect of the null mutation (MT-/-) observed after 3 x 3.4 kJ/m2 of UVB radiation. Immune function was assessed by the contact hypersensitivity (CHS) response, which was initiated by sensitization on unirradiated abdominal skin, and thus demonstrated the systemic effects of dorsal treatments. In comparison with the wild-type MT+/+ mouse, the MT-/- mouse was significantly more immunosuppressed by moderate daily UVB doses (1. 75-5.9 kJ/m2). When topically applied cis-urocanic acid (cis-UCA) replaced UVB radiation as the immunosuppressive agent, contact hypersensitivity in MT-/- mice was again markedly more suppressed than in MT+/+ mice, in a dose-responsive manner. The results infer that MT, which was shown immunohistochemically to be strongly induced in the epidermis of MT+/+ mice, but to be absent in MT-/- epidermis, has the potential to protect from photoimmunosuppression, and that the mechanism of action may be via the inactivation of the epidermal UVB-photoproduct, cis-UCA.

Animals↗

The 10q25 neocentromere and its inactive progenitor have identical primary nucleotide sequence: further evidence for epigenetic modification.

We have previously localized the core centromere protein-binding domain of a 10q25.2-derived neocentromere to an 80-kb genomic region. Detailed analysis has indicated that the 80-kb neocentromere (NC) DNA has a similar overall organization to the corresponding region on a normal chromosome 10 (HC) DNA, derived from a genetically unrelated CEPH individual. Here we report sequencing of the HC DNA and its comparison to the NC sequence. Single-base differences were observed at a maximum rate of 4.6 per kb; however, no deletions, insertions, or other structural rearrangements were detected. To investigate whether the observed changes, or subsets of these, might be de novo mutations involved in neocentromerization (i.e., in committing a region of a chromosome to neocentromere formation), the progenitor DNA (PnC) from which the NC DNA descended, was cloned and sequenced. Direct comparison of the PnC and NC sequences revealed 100% identity, suggesting that the differences between NC and HC DNA are single nucleotide polymorphisms (SNPs) and that formation of the 10q25.2 NC did not involve a change in DNA sequence in the core centromere protein-binding NC region. This is the first study in which a cloned NC DNA has been compared directly with its inactive progenitor DNA at the primary sequence level. The results form the basis for future sequence comparison outside the core protein-binding domain, and provide direct support for the involvement of an epigenetic mechanism in neocentromerization.

Alleles↗