Search PubMed⌕ Search

Biomedical subjects

K E Richards

Publications and source records attributed to K E Richards.

At least 37 records · Page 2Linked to original sources
PubMed1979

Sequence of 1000 nucleotides at the 3' end of tobacco mosaic virus RNA.

The sequence of 1000 nucleotides at the 3' end of tobacco mosaic virus RNA has been determined. The sequence contains the entire coat protein cistron as well as regions to its left and right. Sequence characterization was by conventional methods for use with uniformly 32P labeled RNA complemented by newer methods for in vitro 5' and 3' 32P end-labeling of RNA and its subsequent rapid analysis. The noncoding region separating the coat protein cistron from the 3' terminus is 204 residues long and may be folded into a clover-leaf-type secondary structure. The distribution of termination codons to the left of the coat protein cistron suggests that the end of the adjacent cistron is separated from the beginning of the coat protein cistron by only two nucleotides. The subgenomic viral coat protein mRNA was isolated from infected tissue and shown to be capped. The nontranslated sequence separating the cap from the AUG initiation codon is 9 residues long and thus overlaps a portion of the adjacent cistron on the genome RNA.

Base Sequence↗
PubMed1979

Characterization of long guanosine-free RNA sequences from the Dahlemense and U2 strains of tobacco mosaic virus.

Four naturally occurring strains of tobacco mosaic virus, U2, Dahlemense, CV4, and the bean form of tobacco mosaic virus, were tested for the existence of long T1 RNAase oligonucleotides analogous to the oligonucleotide omega found in the common or U1 strain of tobacco mosaic virus and which makes up the 5' non-coding region of the RNA molecule. U2 and Dahlemense RNA were each found to contain this type of long T1 RNAase oligonucleotide with chain lengths of 54 and 74--77 residues, respectively. The sequence of the two oligonucleotides was determined mostly by using 5'-32P-labelled material in vitro and rapid polyacrylamide gel sequencing techniques.

Base Sequence↗
PubMed1977

Sequence from the assembly nucleation region of TMV RNA.

In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.

Base Sequence↗
PubMed1977

Inside-out model for self-assembly of tobacco mosaic virus.

Incompletely reconstituted particles of tobacco mosaic virus treated with moderate concentrations of dimethylsulfoxide prior to electron microscopy have two visible tails of unencapsidated RNA, a long one and a short one. The short tail has a constant length of 720 +/- 80 nucleotides in incomplete particles of diverse size and probably corresponds to the 3'OH end of the RNA. The length of the long 5' tail is inversely related to the length of the unfinished rod. Surprisingly, both tails appear to protrude from the same end of the particle. These observations suggest that the strand of RNA coming out of one end of the particle loops back along the length of the rod so as to appear at the opposite end. The "looped-back" tail almost certainly passes down the empty central channel of the incomplete rod. The findings are compatible with a model of tobacco mosaic virus assembly in which the RNA inserts itself beneath layers of incoming protein from within the central channel.

Binding Sites↗
PubMed1976

Specific encapsidation of fragments of TMV RNA.

The in vitro reconstitution of tobacco mosaic virus (TMV) is initiated by the binding of a disk of TMV protein to the 'disk recognition site', a region of the RNA chain at or near the 5'-terminus for which the disk has special affinity. In order to gain insight into the recognition process, we have studied the ability of disks to encapsidate short RNA fragments produced by partial pancreatic or T1 RNase digestion of TMV RNA. The disk is capable of dicriminating among such fragments, encapsidating only a few of the many present in the digest. The products of encapsidation are short nucleoprotein rods of the same diameter as TMV and of length proportional to that of the encapsidated RNA fragment. The particles differ from TMV, however, in one significant aspect (apart from their length): they possess rings of RNA-free protein at one or both extremities of the rod. In the case of T1 RNase digestion the principal encapsidated fragments were fragments T1 (105 nucleotides) and a family of smaller fragments containing elements of the same sequence. Partial digestion with pancreatic RNase generated only one major fragment (fragment P1; 150 nucleotides) with affinity for the disk. Fragment T1 has been sequenced and shown to represent a portion of the coat protein cistron. Fragment P1 has been partially sequenced but its function is not yet known. Several lines of evidence indicate that fragment T1 is not the disk recognition site. The portion of the TMV RNA chain from which fragment P1 is derived, on the other hand, is encapsidated early in the reconstitution process; thus fragment P1 may contain the disk recognition site. Fragment T1 and fragment P1 both have purine-rich and cytosine-poor sequences near their termini. In addition, fragment T1, and possibly fragment P1, possess a periodicity of order three in purine residues. It seems likely that one or both of the aforesaid properties are largely responsible for the affinity of these fragments for the disk.

RNA, Viral↗
PubMed1976

Stucture of the amino-acid accepting 3'-end of high-molecular-weight eggplant mosaic virus RNA.

The sequence of the first 59 nucleotides from the 3'-OH terminus of high-molecular-weight eggplant mosaic virus RNA has been determined by standard radio-chemical techniques. The fragment was identified among the products of partial T1 RNase digestion by making use of the reverse migration, at pH 2.5, of the 3'-OH terminal oligonucleotide. No abnormal bases were found. A model of secondary structure may be constructed for this fragment, which is known to fix valine in the presence of valyl-tRNA synthetase. Its relation to the structures of genuine tRNAs and to the 3'-OH termini of other viral RNAs that also accept amino acids is discussed.

Amino Acids↗
PubMed1976

Physical and functional heterogeneity in TYMV RNA: evidence for the existence of an independent messenger coding for coat protein.

Turnip yellow mosaic virus RNA can be separated into two distinct components of 2 times 10(6) and 300 000 daltons molecular weight after moderate heat treatment in the presence of SDS or EDTA. The two species cannot have arisen by accidental in vitro degradation of a larger RNA, as they both possess capped 5' ends. Analysis of the newly synthesized proteins resulting from translation of each RNA by a wheat germ extract shows that the 300 000 molecular weight RNA can be translated very efficiently into coat protein. When translated in vitro the longer RNA gave a series of high molecular weight polypeptides but only very small amounts of a polypeptide having about the same mass as the coat protein. Thus our results suggest that the small RNA is the functional messenger for coat protein synthesis in infected cells.

Genetic Code↗
PubMed1975

Location of the cistron of the tobacco mosaic virus coat protein.

Treatment of tobacco mosaic virus (TMV) RNA with T1 RNase under mild conditions cuts the RNA molecule into a large number of fragments, only a few of which may be specifically recognized by disks of TMV protein. It has been shown elsewhere that these specifically recognized RNA fragments are a part of the coat protein cistron, the portion coding for amino acids 95 to 129 of the coat protein. It is reported that different size classes of partially uncoated virus particles were prepared by limited reconstitution between TMV RNA and protein or by partial stripping of intact virus with DMSO. Both procedures produce nucleoprotein rods in which the 5'-terminal portion of the RNA is encapsidated and the 3'-terminal region is free. The free and the encapsidated portions of the RNA were each tested for the ability to give rise to the aforesaid specifically recognized fragments of the coat protein cistron upon partial T1 RNase digestion. It was found that only the 3'-terminal third of the virus particle need to be uncoated in order to expose the portion of the RNA molecule from which these fragments are derived. We conclude, therefore, that the coat protein cistron is situated upon the 3'-terminal third of the RNA chain, i.e. within 2000 nucleotides of the 3'-end.

Genes↗
PubMed1975

Sequence of a specifically encapsidated RNA fragment originating from the tobacco-mosaic-virus coat-protein cistron.

When 25-S tobacco mosaic virus (TMV) protein aggregate and TMV RNA, which has been partially digested by T1 RNase, are mixed under conditions suitable for reconstitution, only a few RNA fragments are encapsidated. These fragments were isolated and purified by polyacrylamide gel electrophoresis. The sequence of the three main fragments, the longest of which (fragment 1) was estimated to contain 103 nucleotides, has been determined. The two smaller fragments are portions of the longer chain produced by an additional specific scission. Because of the great affinity of 25-S TMV protein for this nucleotide sequence, it will be referred to as the "specifically encapsidated RNA fragment". The occurrence of a "hidden break" in the sequence has been demonstrated: fragment 1, purified by electrophoresis on a polyacrylamide gel without 8 M urea, gives rise upon further electroporesis in the presence of urea to two new bands corresponding to the two halves of the molecule. A stable hair-pin secondary structure has been derived from the base sequence which can account for the specificity of action of the enzyme. Because of its properties, we have suggested elsewhere that the sequence of fragment 1 might correspond to the disk recognition site for reconstitution, which is known to be located at the 5' end of the intact RNA. But experiments with TMV RNA whose 5'-OH end has been radioactively phosphorylated with polynucleotide kinase show that this is not the case. Analysis of the amino acid coding capacity of the fragment has instead revealed that fragment 1 is a portion of the TMV coat protein cistron.

Base Sequence↗
PubMed1975

Observations concerning the sequence of two additional specifically encapsidated RNA fragments originating from the tobacco-mosaic-virus coat-protein cistron.

The incubation of 25-S tobacco mosaic virus (TMV) protein with a mixture of RNA fragments produced by partial T1 RNase digestion of TMV RNA results in the encapsidation of only a few species of RNA. In addition to the most predominant species, fragment 1, whose sequence has been described in the prededing paper, two other species, fragment 41 and fragment 21 are coated by the protein. These two RNA fragments were purified by polyacrylamide gel electrophoresis and subjected to total digestion with pancreatic and T1 RNase. The oligonucleotides were separated by paper electrophoresis and characterized insofar as possible by digestion with the complementary ribonuclease. From the amino acid coding capacity of the oligonucleotides liberated from fragments 41 and 21 by T1 RNase digestion, it appears that these two fragments, like fragment 1, are derived from the coat protein cistron. They are situated immediately prior to fragment 1 and, together with this fragment, consitute a continuous stretch of 232 nucleotides of the cistron which codes for animo acids 53 to 130 of the coat protein. The order of the fragments in the sequence is 21-41-1. A possible model for the secondary structure of this portion of the sequence is proposed.

Amino Acid Sequence↗
PubMed1974

The quaternary structure of delta-aminolevulinic acid dehydratase from bovine liver.

The quaternary structure of delta-aminolevulinic acid dehydratase (5-aminolaevulinate hydrolyase, EC 4.2.1.24) from bovine liver was examined by analytical ultracentrifugation, polyacrylamide gel electrophoresis, and electron microscopy. The molecular weights, determined by sedimentation-velocity and sedimentation-equilibrium experiments, were 289,000 and 282,000, respectively. The molecular weight of the subunit in 6 M guanidine. HCl was 34,900 as determined by sedimentation-equilibrium and 35,000 as estimated by polyacrylamide gel electrophoresis. No evidence was obtained for the presence of a smaller polypeptide. It appears therefore that delta-aminolevulinic acid dehydratase from liver is composed of eight subunits. The molecules of the enzyme deposited in thin layers of negative stain were generally square with an edge length of 85-90 A. On the assumption that the subunits are spherical in shape with a diameter of 44 A and a density of 1.36 g/cm(3), the molecular weight of the octamer is calculated to be 292,000. The particles appear to consist of four discrete lobes arrayed at the four corners of a square. The above conclusion that the dehydratase possesses eight subunits can be readily reconciled with the appearance of the enzyme in the electron microscope if it is postulated that the eight subunits are arranged at the corners of a cube. Therefore, it would follow that the subunits are arranged with dihedral (D(4)) symmetry.

Animals↗