Search PubMed⌕ Search

Biomedical subjects

J Shine

Publications and source records attributed to J Shine.

At least 91 records · Page 5Linked to original sources

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene.

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.

Animals↗

Structural and functional analysis of nitrogenase genes from the broad-host-range Rhizobium strain ANU240.

The genes encoding the structural components of nitrogenase, nifH, nifD and nifK, from the fast-growing, broad-host-range Rhizobium strain ANU240 have been identified and characterized. They are duplicated and linked in an operon nifHDK in both copies. Sequence analysis of the nifH gene from each copy, together with partial sequence analysis of the nifD and nifK genes, and restriction endonuclease analysis suggested that the duplication is precise. Comparison of the Fe-protein sequence from strain ANU240 with that from other nitrogen-fixing organisms revealed that, despite its broad host range and certain physiological properties characteristic of Bradyrhizobium strains, ANU240 is more closely related to the narrow-host-range Rhizobium strains than to the broad-host-range Bradyrhizobium strains. The promoter regions of both copies of the nif genes contain the consensus sequence characteristic of nif promoters, and functional analysis of the two promoters suggested that both nif operons are transcribed in nodules.

Amino Acid Sequence↗

Pre- and postjunctional actions of neuropeptide Y and related peptides.

The effects of neuropeptide Y (NPY) and related peptide fragments on blood pressure and vagal action at the heart were compared in the anaesthetized rat. A change in vagal action was taken as a measure of presynaptic activity and a change in blood pressure was taken as a measure of postsynaptic activity. NPY, NPY-(13-36), PYY-(13-36), des-Ser22-NPY-(13-36) and a stabilized 13-36 analogue of NPY (ANA NPY) all exerted pressor actions and attenuated vagal action at the heart. The maximum vagal inhibitory or presynaptic action in order of potency was NPY, ANA-NPY, PYY-(13-36) significantly greater than NPY-(13-36), des-Ser22-NPY-(13-36). The order of potency for the half time of this effect was NPY, ANA-NPY significantly longer than PYY-(13-36) and NPY-(13-36), which were significantly longer than des Ser22-NPY-(13-36). For the pressor or postsynaptic effects, NPY increased blood pressure significantly more and for a longer duration than all the 13-36 fragments, which were not demonstrably different in this respect. These results are consistent with the proposal that there are two populations of NPY receptors. The C-terminal flanking peptide of NPY (CPON) and desamido-NPY had no effect on either vagal action at the heart or on blood pressure.

Animals↗

The major dopamine D2 receptor: molecular analysis of the human D2A subtype.

The structural diversity of the human D2 dopamine receptor was examined at the nucleic acid level. Sequence analysis of receptor cDNA clones isolated from human brain and pituitary libraries and polymerase chain reaction (PCR) analysis of rat brain RNA and human genomic DNA demonstrate the presence of a predominant D2 subtype, D2A. The D2A subtype differs from the D2B subtype, previously described in rat brain RNA, in that an additional 29 amino acids are present in the putative third cytoplasmic domain, a region thought to be important for coupling to different G-proteins. The demonstration of intron sequences flanking the DNA encoding the 29-amino-acid insertion suggests that the generation of two distinct D2 dopamine receptor subtypes may arise from alternative splicing of a common genomic sequence.

Amino Acid Sequence↗

Progestin inhibition of progesterone receptor gene expression in human breast cancer cells.

The present study was designed to investigate whether inhibition of progesterone receptor (PR) gene transcription and/or regulation of PR mRNA half-life were involved in the progestin-mediated decrease of PR in T-47D human breast cancer cells. Cells were treated with the progestin ORG 2058 and PR mRNA measured by Northern blot analysis of total RNA. A major PR mRNA around 13.5 kilobases and minor species around the 28S ribosomal RNA subunit were decreased upon ORG 2058 treatment. The decrease was not detectable until 2-3 h after treatment and was the same at all ORG 2058 concentrations (1-100 nM) tested. The decrease in PR mRNA was unaffected by actinomycin D in the first 3 h but was inhibited thereafter. There was a partial recovery of PR mRNA levels 24 h after ORG 2058 exposure. Immunoblot analysis showed that immunoreactive PR decreased in parallel with PR mRNA. The rate of protein loss in the first 12 h after progestin treatment was related to the ORG 2058 concentration used. Nuclear run-on experiments showed that ORG 2058 caused a decrease of up to 70% in the transcription rate of the PR gene. The half-life of PR mRNA was shown to be 2-2.5 h by [3H]uridine incorporation, which was much shorter than estimates obtained using actinomycin D, and was unaffected by ORG 2058. In summary, these data have shown that the mechanism by which progestins decrease the concentration of PR includes inhibition of transcription of the PR gene.

Blotting, Northern↗

Genetic instability and the development of steroid hormone insensitivity in cultured T 47D human breast cancer cells.

The estrogen receptor (ER)-positive human breast cancer cell line T 47D exhibited genetic instability under cell culture conditions which maintained almost continuous exponential growth. This resulted in the spontaneous generation of three ER-positive sublines with a range of DNA ploidies and distinctive phenotypes. One of these sublines, T 47D-5, exhibited resistance to the growth-inhibitory effects of the synthetic nonsteroidal antiestrogen tamoxifen and the synthetic progestin ORG 2058, in marked contrast to "wild type" T 47D cells (designated T 47D-7 in this study). T 47D-5 cells were cloned by limiting dilution and 11 clonal cell lines were tested for sensitivity to tamoxifen. Although all clones of T 47D-5 were significantly less sensitive than T 47D-7 cells, a spectrum of sensitivities was observed. Three clones, T 47D-5-13, T 47D-5-21, and T 47D-5-23, were further characterized by measuring the concentrations of receptors for estrogen, progesterone, growth hormone, and epidermal growth factor and responses to estradiol, tamoxifen, and progestin, in terms of both induction of specific proteins and effects on cellular proliferation. Although the T 47D-5 subline and clone T 47D-5-23 were insensitive to both the growth-stimulatory effects of estradiol and the inhibitory effects of tamoxifen, this was not related to the concentration of ER or its ability to induce progesterone receptor. Estrogen receptor levels were similar in resistant and sensitive clones of T 47D-5 [70,000-81,000 sites/cell] and were 2.5-fold greater than in the sensitive T 47D-7 line [32,600 +/- 5,000 (SEM) sites/cell]. Northern blots showed no difference in the size of ER mRNA transcripts between sensitive and resistant clones. Estradiol treatment increased progesterone receptor (PR) levels in all cell lines but the magnitude and sensitivity of this response were unrelated to growth responses indicating a divergence in estrogenic control of cellular proliferation and specific protein synthesis within these clones. T 47D-5, T 47D-5-13, T 47D-5-21, and T 47D-5-23 were all insensitive to the growth-inhibitory effects of ORG 2058. The progestin was also unable to increase lactogenic and epidermal growth factor receptor concentrations in these four lines in contrast to the response in T 47D-7 cells. The insensitivity to progestin in the T 47D-5 subline and its three clonal cell lines could be accounted for, in part, by a 75-80% reduction in PR levels when compared with T 47D-7 cells.(ABSTRACT TRUNCATED AT 400 WORDS)

Breast Neoplasms↗

Cloning and expression of full-length cDNA encoding human vitamin D receptor.

Complementary DNA clones encoding the human vitamin D receptor have been isolated from human intestine and T47D cell cDNA libraries. The nucleotide sequence of the 4605-base pair (bp) cDNA includes a noncoding leader sequence of 115 bp, a 1281-bp open reading frame, and 3209 bp of 3' noncoding sequence. Two polyadenylylation signals, AATAAA, are present 25 and 70 bp upstream of the poly(A) tail, respectively. RNA blot hybridization indicates a single mRNA species of approximately equal to 4600 bp. Transfection of the cloned sequences into COS-1 cells results in the production of a single receptor species indistinguishable from the native receptor. Sequence comparisons demonstrate that the vitamin D receptor belongs to the steroid-receptor gene family and is closest in size and sequence to another member of this family, the thyroid hormone receptor.

Amino Acid Sequence↗

Human renin is correctly processed and targeted to the regulated secretory pathway in mouse pituitary AtT-20 cells.

Renin is formed by intracellular processing of prorenin and catalyzes the conversion of angiotensinogen to angiotensin I, the precursor to angiotensin II. Several tissues synthesize prorenin. However, in man, the kidney is the only known source of circulating renin, raising the possibility that the processing enzyme is unique to that tissue. We have transfected a gene that directs prorenin synthesis in pituitary AtT-20 cells, which are capable of processing other prohormones. The results demonstrate that transfected AtT-20 cells can secrete inactive prorenin, accurately process prorenin to active renin, and be stimulated to release active renin in response to a secretagogue. These data imply that cellular elements capable of directing the processing of prorenin to renin and its correct subcellular compartmentalization may be present in nonrenal cell types and that critical elements of the regulated release of renin that occur in the kidney can be reconstituted in cells in culture.

Amino Acid Sequence↗

Porcine relaxin. Gene structure and expression.

A porcine genomic cosmid library was constructed to study the structure and regulation of the porcine relaxin gene. Two overlapping cosmids containing relaxin-specific sequences were isolated, and a 9-kilobase BamHI fragment containing the porcine relaxin gene was sequenced. The sequence derived from these cosmids was used to characterize the relaxin gene transcription unit utilized in the pregnant ovary. Analysis of chromosomal and cosmid DNA has shown that porcine relaxin is encoded by a single copy gene, comprising two exons separated by a 5.5-kilobase intron. The gene contains elements representing two classes of repeated sequences homologous with the human Alu and Kpn families. The transcriptional initiation site of this gene was located by primed extension and direct sequencing of relaxin-specific cDNA. Furthermore, the promoter elements were mapped and sequenced, and transcriptional activity was demonstrated. The promoter contained sequences with homology to regions conserved within retroviral long terminal repeats and within the adenovirus E4 promoter.

Animals↗

Recent evolutionary divergence of plasma prekallikrein and factor XI.

The evolution in mammals of the zymogens of the contact activation system of coagulation (factor XII, prekallikrein and factor XI) has been investigated. The NH2-terminal sequences of human plasma prekallikrein and the heavy and light chains of kallikrein have been determined and compared with those of bovine prekallikrein and of human and bovine factors XII and XI. The human and bovine NH2-terminal sequences of the light chains (catalytic polypeptide) show striking similarities both among themselves and with those of the catalytic polypeptide chains of other coagulation and digestive proteases, indicating a common origin. Comparison of the NH2-terminal sequences of human prekallikrein with those of the bovine prekallikrein and human bovine factors XIa and XIIa indicates a common origin of the heavy chain of kallikrein and factor XIa, different from that of either factor XIIa or other known amino acid sequences. Ancestral sequences for human and bovine prekallikrein and factor XI, deduced by genetic analysis of the minimum number of base changes indicate that the NH2-terminus of prekallikrein and factor XI have evolved at about the same rate. The estimated time for the gene duplication was about 124 million years ago, a value consistent with the age of the mammals.

Amino Acid Sequence↗

Sequence and expression of human estrogen receptor complementary DNA.

The mechanism by which the estrogen receptor and other steroid hormone receptors regulate gene expression in eukaryotic cells is not well understood. In this study, a complementary DNA clone containing the entire translated portion of the messenger RNA for the estrogen receptor from MCF-7 human breast cancer cells was sequenced and then expressed in Chinese hamster ovary (CHO-K1) cells to give a functional protein. An open reading frame of 1785 nucleotides in the complementary DNA corresponded to a polypeptide of 595 amino acids and a molecular weight of 66,200, which is in good agreement with published molecular weight values of 65,000 to 70,000 for the estrogen receptor. Homogenates of transformed Chinese hamster ovary cells containing a protein that bound [3H]estradiol and sedimented as a 4S complex in salt-containing sucrose gradients and as an 8 to 9S complex in the absence of salt. Interaction of this receptor-[3H]estradiol complex with a monoclonal antibody that is specific for primate ER confirms the identity of the expressed complementary DNA as human estrogen receptor. Amino acid sequence comparisons revealed significant regional homology among the human estrogen receptor, the human glucocorticoid receptor, and the putative v-erbA oncogene product. This suggests that steroid receptor genes and the avian erythroblastosis viral oncogene are derived from a common primordial gene. The homologous region, which is rich in cysteine, lysine, and arginine, may represent the DNA-binding domain of these proteins.

Amino Acid Sequence↗

Characterization of human prorenin expressed in mammalian cells from cloned cDNA.

Human preprorenin was synthesized in Chinese hamster ovary (CHO) cells transfected with an expression vector containing renin cDNA sequences. These cells secrete an inactive form of renin (EC 3.4.23.15) that can be activated by trypsin. This inactive renin is precipitable by antibody generated against purified human renal renin and also by antisera generated to a synthetic peptide derived from the amino acid sequence of the pro segment of preprorenin (anti-propeptide), indicating that the secreted inactive enzyme is a form of prorenin. Analysis of [35S]methionine-labeled proteins immunoprecipitated from CHO cell conditioned culture medium indicates that prorenin is expressed in CHO cells as two distinct forms that differ in their degree of glycosylation. In vitro trypsin activation of prorenin cleaves approximately 4.5 kDa from the protein, rendering it unreactive with the antipropeptide antiserum but still recognizable by anti-renal renin antibody. These results show directly that the prorenin expressed by CHO cells is an inactive enzyme that is activated by trypsin cleavage of the pro segment. The ability to express human renin in this form will allow for the purification of both active and inactive forms of the enzyme in quantities sufficient for detailed physiological and structural studies.

Animals↗

Biochemical similarity of expressed human prorenin and native inactive renin.

Prorenin is secreted by mammalian cells transfected with a human preprorenin expression construct. The purpose of this investigation was to compare the physicochemical properties of expressed prorenin in culture medium with the known characteristics of human inactive renin, which accounts for nearly half the renin in plasma and kidney. We found that expressed human prorenin strongly resembles human renal and plasma inactive renin. The expressed prorenin was inactive and could be equally activated by acid (dialysis to pH 3.3) or trypsin. Acid activation was completely reversible; reexposure to acid could reactivate the expressed inactive renin. Exposure to cold (-5 degrees C for 3 days) could also activate expressed renin. The Michaelis-Menten constant of acid-activated expressed renin with sheep substrate was 0.29 microM, and the pH optimum was 7.8. Expressed inactive renin bound to a cibacron-blue affinity column and could be eluted with 0.5M NaCl. All the above characteristics resemble those of human renal and plasma inactive renin. In addition, the molecular weight of expressed prorenin and human chorionic renin was 47,000, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and 46,000, as measured by high-performance liquid chromatography. These data, taken together with the published observation that native human inactive renin cross-reacts with antibodies generated against amino acid sequences in the prosegment of renin, provide strong support for the hypothesis that human inactive renin is prorenin.

Cold Temperature↗

Human kidney kallikrein: cDNA cloning and sequence analysis.

The primary structure of human kidney kallikrein has been elucidated by molecular cloning and cDNA sequence analysis. Structural homology between mammalian glandular kallikreins permitted the isolation of several clones from a human kidney cDNA library where kallikrein sequences represented approximately 0.01% of the cDNA. Identity of the cloned sequence with the published amino-terminal sequence of human urinary kallikrein strongly implicates the kidney as a major source of this protein. The overall structure of the kidney enzyme is 67% homologous to that of the corresponding mouse kidney kallikrein and only 60-62% homologous to the other published mouse kallikrein sequences. Homology to the pancreatic kallikreins of pig and rat is 67% and 61%, respectively. As expected, the amino acids required for catalytic activity are conserved as is the Asp residue required for the kallikrein-type specificity. Southern blot analysis demonstrates the presence of a number of related sequences in human DNA, although these do not appear to be as numerous as those in the mouse genome. Several polymorphisms in the kallikrein genes were observed.

Amino Acid Sequence↗

Structural analysis of the genes encoding the molybdenum-iron protein of nitrogenase in the Parasponia rhizobium strain ANU289.

The genes encoding the Molybdenum-Iron protein component of nitrogenase (nifD and nifK) have been identified and fully characterised in the Parasponia Rhizobium strain ANU289. The two genes are contiguous and are separated from the gene encoding the Fe-protein component of nitrogenase (nifH) by 21 kb of DNA. We present the entire DNA sequence of the nifD and nifK genes, thus completing the characterisation of the primary structure of the nitrogenase genes in this Rhizobium strain. Comparison of the sequence preceding the transcription initiation point of nifDK with that preceding nifH reveals a consensus promoter sequence 5'-PyTGGCAPyG-4 bp-TTGC(T/A)-10 bp-3'. This consensus promoter is found preceding nif genes in both fast-growing and slow-growing Rhizobium strains and shows a structural similarity to that preceding the coordinately-regulated nif operons in the asymbiotic organism Klebsiella pneumoniae.

Base Sequence↗