Search PubMed⌕ Search

Biomedical subjects

J R Sadler

Publications and source records attributed to J R Sadler.

At least 19 recordsLinked to original sources

A silent deletion in the beta-globin gene cluster.

A survey of the gamma-globin gene region of over 1000 normal individuals revealed a novel 2.5 kb deletion which removes the 5' end of the A gamma-globin gene. Unusually, this deletion in the beta-globin gene cluster is not associated with increased fetal haemoglobin production. Sequence analysis of the deletion endpoints revealed no significant homology at the breakpoint and failed to support a role for a proposed recombination hotspot in IVS-2 in the generation of this illegitimate recombination event. The existence of small "silent" deletions in the beta-globin gene cluster emphasizes the importance of deletion size in altering expression of the fetal globin genes.

Base Sequence↗

Virion component of herpes simplex virus type 1 KOS interferes with early shutoff of host protein synthesis induced by herpes simplex virus type 2 186.

Herpes simplex virus (HSV) strains HSV type 1 (HSV-1) KOS and HSV-2 186 are representative of delayed and early shutoff strains, respectively, with regard to their ability to inhibit protein synthesis in Friend erythroleukemia cells. When these cells were simultaneously infected with HSV-1 KOS and HSV-2 186, HSV-1 KOS interfered with the rapid suppression of globin synthesis induced by HSV-2 186. The observed interference was competitive and not due to exclusion of HSV-2 by HSV-1 at the level of adsorption. Furthermore, UV-irradiated HSV-1 KOS was also effective at interfering with the early shutoff function of HSV-2 186, indicating that a virion component is responsible for the observed interference.

Animals↗

Regulated high-level expression of the Herpes simplex type I thymidine kinase gene in Escherichia coli.

A plasmid-borne Herpes simplex virus type 1 (HSV-1) thymidine kinase (TK) gene (tk) was expressed in Escherichia coli by inserting a 203-bp lacL8/UV5 promoter-operator segment, in frame, 53 bp 5' to the native tk translational start codon. The hybrid gene created by this fusion encodes a polypeptide which has 25 additional amino acids on the amino terminus of the HSV-1 TK protein and phenotypically complements a tdk- mutation of E. coli. This fusion polypeptide has been characterized by maxicell, immunoprecipitation, and native gel techniques, and its activity is inhibited by anti-HSV-1 antibody. In a tk expressor strain containing a F' lacIq (which overproduces the lactose repressor), the isopropyl-beta-D-thiogalactoside (IPTG) causes greater than 1000-fold coordinate induction of the plasmid-encoded TK and chromosomal beta-galactosidase activities. Pulse-chase induction demonstrates the fused TK polypeptide to be as stable as beta-galactosidase. HSV-1 tk-specific RNA isolated from this bacterial strain has a short half-life characteristic of bacterial messages.

Cloning, Molecular↗

NMR study of the interaction between the lac repressor and the lac operator.

Binding of the lac repressor headpiece, the N-terminal region of the lac repressor, to the lac operator of Escherichia coli was studied by 1H-NMR spectroscopy. Two DNA fragments, of 51 base pairs and 62 base pairs, containing the lac operator region, were investigated. The signals of their hydrogen-bonded imino protons were well resolved in the 500-MHz NMR spectra. The spectra of the free lac operator DNA are similar to those obtained from ring-current-shift calculations for a B-DNA structure. Complex formation with the headpiece led to small but nevertheless characteristic changes in the spectra. The fact that very few imino resonances shifted upon addition of headpiece, as well as the variety in direction and size of these chemical shifts, indicate the formation of a specific complex between the lac repressor and the lac operator. The observed changes in the resonance positions exclude the intercalation of tyrosine residues of the headpiece between adjacent base pairs of the lac operator as well as the formation of a cruciform structure. They rather reflect a small conformational transition in the DNA itself, caused for example by an alteration in the tilt of a few base pairs or a shift of the keto-enol tautomeric equilibrium of the bases towards the enolic form.

Bacterial Proteins↗

Statistical characterization of nucleic acid sequence functional domains.

It has long been recognized that various genome classes were distinguishable on the basis of base composition and nearest neighbor frequencies. In addition Grantham et al. (8) have recently presented evidence that these distinctions are preserved at the level of codon usage. As discussed in this report it is now clear that these and related statistics can uniquely characterize the various functional domains of the genome. In particular peptide coding, intervening segments, structural RNA coding and mitochondrial domains of the vertebrate genome are uniquely characterizable. The statistical measures not only reflect understood functional differences among these domains but suggest others. The ability of these simple statistics of nucleic acid sequences to reflect so much of the encoded complex pattern information and/or effects of selective constraints is somewhat surprising. Here, we investigated the statistical measures most distinctive of the various domains and then linked them to our current understandings in so far as possible.

Animals↗

Regulatory pattern identification in nucleic acid sequences.

In addition to the sequence homologies and statistical patterns identified among numerous genetic sequences, there are subtler classes of patterns for which most current computer search methods offer very limited utility. This class includes various presumptive eukaryotic regulatory sites. A critique of the often employed consensus and local homology methods suggests the need for new tools. In particular, such new methods should use the positional and structural data now becoming available on exactly what it is that is recognized in the DNA sequence by sequence-specific binding proteins.

Animals↗

A perfectly symmetric lac operator binds the lac repressor very tightly.

A completely symmetric DNA segment has been constructed that binds the lactose repressor of Escherichia coli 10-fold more tightly than does the natural lactose operator sequence. This tight-binding operator is an inverted repeat of a 15-base-pair segment from the left half of the natural operator sequence, the inversion being about the point indicated by the arrow shown below: (sequence in text) where the upper sequence is the natural operator and the lower sequence is the symmetric operator. The increased affinity of repressor for this symmetric sequence supports the idea that the tetrameric repressor is designed for a two-module binding to DNA, presumably via two (or two pairs) of its identical subunits. The natural operator is apparently "flawed" by "incorrect" base pairs in the right operator half and by an "incorrect" spacing between the operator halves with respect to maximal repressor binding.

Base Sequence↗

Herpes simplex virus types 1 and 2 induce shutoff of host protein synthesis by different mechanisms in Friend erythroleukemia cells.

Herpes simplex virus type 1 (HSV-1) and HSV-2 disrupt host protein synthesis after viral infection. We have treated both viral types with agents which prevent transcription of the viral genome and used these treated viruses to infect induced Friend erythroleukemia cells. By measuring the changes in globin synthesis after infection, we have determined whether expression of the viral genome precedes the shutoff of host protein synthesis or whether the inhibitor molecule enters the cells as part of the virion. HSV-2-induced shutoff of host protein synthesis was insensitive to the effects of shortwave (254-nm) UV light and actinomycin D. Both of the treatments inhibited HSV-1-induced host protein shutoff. Likewise, treatment of HSV-1 with the cross-linking agent 4,5',8-trimethylpsoralen and longwave (360-nm) UV light prevented HSV-1 from inhibiting cellular protein synthesis. Treatment of HSV-2 with 4,5',8-trimethylpsoralen did not affect the ability of the virus to interfere with host protein synthesis, except at the highest doses of longwave UV light. It was determined that the highest longwave UV dosage damaged the HSV-2 virion as well as cross-linking the viral DNA. The results suggest that HSV-2 uses a virion-associated component to inhibit host protein synthesis and that HSV-1 requires the expression of the viral genome to cause cellular protein synthesis shutoff.

Animals↗

Transcription from the BamHI J fragment of herpes simplex virus type 1 (KOS).

RNA transfer experiments (Northern analyses) were used to localize polyadenylated mRNA species made after herpes simplex virus type 1 infection to EcoRI and BamHI fragments and subfragments from the short unique region of the herpes simplex virus type 1 (KOS) genome. Three predominant early mRNAs of 2.5, 1.3, and 0.9 kilobases map in the BamHI J fragment. A detailed restriction map of the BamHI J fragment was constructed.

Cell Line↗

RNAs transcribed from a 3.6-kilobase SmaI fragment of the short unique region of the herpes simplex virus type 1 genome.

A 3.6-kilobase (kb) SmaI subclone of the BamHI J fragment of herpes simplex virus type 1 (KOS) DNA was utilized to characterize the mRNAs transcribed from the genome segment (0.91 to 0.93 map units) that encodes glycoprotein D mRNA. RNA blotting demonstrated two major RNA species of 2.3 and 1.5 kb. 5' and 3' mapping with 32P-end-labeled DNA fragments indicated that these RNAs are a nested set, each having its own promoter and 3' terminus. Less abundant RNA species with discrete 5' ends were also observed. Precise 5' mapping and sequence data located the initiation sites and demonstrated TATA boxes, CAT boxes, and AC-rich regions in the appropriate positions. 3' mapping located a common end for both mRNAs, but the 2.3-kb mRNA was reduced in size by splicing at a point near the RNA terminus. In vitro runoff transcription experiments confirmed the location of the two promoters and showed that an uninfected cell extract initiated faithfully at both sites. Despite the similarities in DNA structure and the apparent equal efficiency of promoter utilization in vitro, the 2.3-kb mRNA appeared in the cytoplasm early (1 h) after infection, whereas the 1.5-kb mRNA was delayed until 3 h after infection.

Base Sequence↗

Determination of the ligand-binding characteristics of several tight-binding mutants of the lactose repressor protein.

Several tight-binding mutants of the lactose repressor protein have been characterized with respect to their fluorescence properties and their inducer, operator and nonspecific DNA-binding constants. The tryptophan fluorescence emission spectra for the mutants and the wild-type repressor are quite similar. However, alterations in the Stern-Volmer constants for iodide quenching of the tryptophans in the mutant proteins compared to wild-type suggest differences in the local environment or solvent accessibility for these amino acids in the tight-binding repressors. The inducer-binding affinities and association rate constants of the mutant proteins and protein-operator DNA fragment complexes are also altered compared to wild-type. The extents of these changes vary among the different mutant repressors. The nonspecific DNA-binding affinities of the mutant proteins are 2--3-fold greater than the wild-type repressor, and the affinities of the tight-binding proteins for a 29 base-pair operator DNA fragment are also increased, though to a varying extent depending upon the mutant. The phenotypic behavior of these proteins in vivo can be partially explained by these results obtained in vitro; however, it is likely that there are additional factors responsible for the tight-binding behavior of the proteins that were not detectable in these experiments.

Alleles↗

Plasmids containing many tandem copies of a synthetic lactose operator.

Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.

Base Sequence↗

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.

Base Sequence↗

Cloning of the lacI gene into A ColE1 plasmid.

The binding of lac repressor to lac operator was utilized to isolate an EcoRI fragment of lambda h80dlac (i+ as well as iq) that contains the lacI gene and lac promoter-operator regions. Ligation of this fragment into EcoRI cleaved pMB9 yielded chimeric DNA molecules of mol. w.t. 9.6 . 10(-6) and 1.5 . 10(7) daltons. Transformed strains containing the plasmids were analyzed for repressor production in vivo and in vitro. Repressor production in one plasmid strain is 7-fold greater than that in heat-inducible lambda h80dlac(iq)lysogens.

Coliphages↗

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.

Coliphages↗

Pseudoreversion of lactose operator-constitutive mutants.

A set of pseudorevertants of lactose operator-constitutive (lacOc) mutant has been obtained. Analysis of a subset of these pseudorevertants indicates that, in some cases, the secondary mutation alters the lactose repressor (lacl gene product), whereas in others it seems to have occurred in the lactose operator (lacO) itself. Of the lacl gene mutations, the lacl8 mutation, already known to suppress all lacOc mutations nonspecifically, was recovered by a selection technique developed for this study. However, two additional lacl gene mutants were selected which appear to suppress lacOc sequences in a more-or-less specific fashion; repressor interaction with some operator sequences is facilitated, whereas the binding with lacO+ and others is attenuated concomitantly.

Escherichia coli↗