Search PubMed⌕ Search

Biomedical subjects

J M Hudson

Publications and source records attributed to J M Hudson.

At least 19 recordsLinked to original sources

Feeding practices associated with colic in horses.

OBJECTIVE: To determine whether specific feeding practices were associated with development of colic in horses. DESIGN: Prospective matched case-control study. ANIMALS: 364 horses examined by veterinarians in private practice in Texas because of colic (cases; n = 182) or any other reason (controls; 182). PROCEDURE: Participating veterinarians were sent forms at the beginning of the study to collect information on signalment, feeding management practices, farm management practices, and preventive medical treatments. Case and control horses were compared by use of conditional logistic regression to identify factors associated with colic. RESULTS: Risk factors for colic were a recent change in batch of hay, decreased exposure to pasture, a recent change in type of grain or concentrate fed, feeding > 2.7 kg (6 lb) of oats/d, feeding hay from round bales, and Thoroughbred breed. Recent anthelmintic administration decreased the risk of colic. CONCLUSIONS AND CLINICAL RELEVANCE: Results suggest that certain changes in diet (eg, change in batch of hay, change in type of grain or concentrate, feeding hay from round bales) and management (eg, decreased availability of pasture) increase the risk of colic in horses.

Animal Feed↗

Antisense inhibition of vascular endothelial growth factor in human head and neck squamous cell carcinoma.

BACKGROUND: Vascular endothelial growth factor (VEGF) is a potent paracrine angiogenic factor involved in angiogenesis. We determined whether antisense VEGF transfection can suppress angiogenic activity of a human squamous cell carcinoma of the head and neck (SCCHN) cell line. METHODS: Human SCCHN cell lines were screened for VEGF secretion by ELISA. The highest VEGF secreting cell line was transfected with an antisense VEGF vector. Endothelial cell migration assays were performed using the conditioned medium from the transfected clones. Tumorigenicity assays of the transfectants in nude mice were also performed. RESULTS: Antisense VEGF expression exhibited a 20-fold inhibition of VEGF secretion. The addition of conditioned medium from the antisense clones resulted in 50% reduction of endothelial migration. There was no effect on in vivo tumorigenicity. CONCLUSIONS: Antisense VEGF transfection effectively down-regulated VEGF secretion from SCCHN cells that had high VEGF secretion. Targeting VEGF expression may be useful for suppressing angiogenesis in head and neck cancer.

Angiogenesis Inducing Agents↗

Reduced recognition of metastatic melanoma cells by autologous MART-1 specific CTL: relationship to TAP expression.

Class I expression in context with T-cell receptor expression is crucial for peptide presentation and induction of CD8+ cytotoxic T lymphocytes (CTL). Presentation of class I bound peptides is dependent on transporter-associated proteins (TAP) expression and function. Tumor infiltrating lymphocytes from a patient with melanoma were isolated, expanded in vitro in the presence of interleukin-2, and tested for cytotoxicity against HLA-A2 positive, MART-1 positive autologous tumor cells, an HLA-A2-positive, MART-1 positive melanoma cell line (Mel-501), and HLA-A2-negative melanoma cells. Significant killing occurred against both A2-positive cell lines (63% and 65%, respectively), but not against the A2-negative line (18%) or A2-positive autologous tumor (1.5%). These CTL preferentially recognized the MART-1 peptide F119, 27-35, and gp100 peptide F125, 280-288, resulting in a 30% to 60% enhancement of lysis when autologous tumor or major histocompatibility complex class I "empty" T2 cells were pulsed with either peptide. To address whether the deficiency in autologous tumor recognition might be related to a deficiency in Ag presentation, we screened for the presence of TAP1 and TAP2 transcripts by polymerase chain reaction, Southern blotting, and scanning densitometry using sequence-specific primers and probes. Both TAP1 and TAP2 expression levels in the autologous tumor were minimal, yet were upregulated 7- to 18-fold, respectively, by interferon-gamma. Despite this increase, a similar increase in cytotoxicity did not occur. In short, deficiencies in TAP presentation may have functional significance for tumor escape from immunosurveillance and with respect to impending vaccine trials.

ATP Binding Cassette Transporter, Subfamily B, Mem↗

HER-2/neu peptide specificity in the recognition of HLA-A2 by natural killer cells.

Although natural killer (NK) cells have been described as non-MHC-restricted, new evidence suggests that NK activity can be either up- or down-regulated after interaction with the peptide-MHC-class-I complex expressed on target cells. However, the epitope(s) recognized by NK cells have remained ill-defined. We investigated NK cell recognition of synthetic peptides representing a portion of a self-protein encoded by the HER-2/neu (HER-2) proto-oncogene and presented by HLA-A2. HER-2 nonapeptides C85, E89, and E75 were found partially to protect T2 targets from lysis by freshly isolated and interleukin-2(IL-2)-activated NK cells (either HLA-A2(+) or A2(-)). This inhibition was not solely due to changes in the level of HLA-A2 expression or conformation of serological HLA-A2 epitopes. Using single-amino-acid variants at position 1 (P1) of two HER-2 peptides, we observed that protection of targets was dependent on the sequence and the side-chain. These results suggest similarities in the mechanism of target recognition by NK and T cells. This information may be important for understanding the mechanisms of tumor escape from immunosurveillance and could help explain the aggressiveness of HER-2-overexpressing tumor cells.

Cells, Cultured↗

In vitro growth suppression by adenoviral transduction of p21 and p16 in squamous cell carcinoma of the head and neck: a research model for combination gene therapy.

OBJECTIVES: To determine the duration of expression of the cell cycle regulators p21 and p16 and the effect of these 2 genes both alone and in combination on the growth of squamous cell carcinoma of the head and neck cell lines in vitro. EXPERIMENTAL METHODS AND DESIGN: Cells were transduced via an adenoviral vector with p21 (Ad5CMV-p21), p16 (Ad5CMV-p16), or both. Western blotting was performed to determine duration of expression of the protein products of the transduced p21 and p16 genes. In vitro growth assays and cell cycle analyses were performed on transduced cells. RESULTS: Transduced gene products were detected up to day 12 after infection. Western blotting showed high levels of p21 and p16 in transduced cells. Growth suppression was observed in squamous cell carcinoma of the head and neck cell lines transduced with Ad5CMV-p21, Ad5CMV-p16, or both, but the combination of p21 and p16 did not achieve significantly greater growth suppression than that seen in cells transduced with Ad5CMV-p16 alone. Cell cycle analysis demonstrated that the percentage of cells arrested at G1 stage in the cells transduced with Ad5CMV-p16 was similar to that in the cells transduced with both Ad5CMV-p21 and Ad5CMV-p16. No significant in vivo growth suppression was observed in tumor nodules treated with Ad5CMV-p16. CONCLUSIONS: Although p21 and p16 are believed to function as cell cycle regulators of cyclin-dependent kinases, we observed no additive or synergistic effect when using them in combination. The expression of transduced p21 and p16 gene products up to days 9 and 12, respectively, was consistent with the growth suppression and cell cycle arrest observed. This work provides information on the previously uncharacterized duration of p21 and p16 transgene product expression and also lends insight into the interaction of these 2 cell cycle regulators in squamous cell carcinoma of the head and neck.

Adenoviruses, Human↗

Growth and antigen recognition of tumor-infiltrating lymphocytes from human breast cancer.

In the present study, we isolated tumor-infiltrating lymphocytes (TIL) from 21 primary solid tumors and tumor-associated lymphocytes (TAL) from 9 malignant effusions, respectively, of breast cancer patients. Significant proliferation and expansion of T cells was observed in 23 of 30 distinct samples. TIL were isolated from primary tumors by either enzymatic digestion or mechanical disruption. The TIL cultures were initiated using OKT3 mAb in the presence of moderate concentrations (25-50 U/ml) of IL-2, followed by 100 U/ml of tumor necrosis factor (TNF)-alpha. TAL were not stimulated with OKT3 mAb, but all were successfully expanded in culture in the presence of IL-2 alone or together with TNF-alpha. Seven of nine distinct TAL grew in culture as predominantly CD4+ lines. In contrast, only 14 of 21 (66%) of primary breast TIL expanded in culture and were predominantly of CD8+ phenotype. Autologous tumor lysis was observed in seven of eight cases tested. Only one of the four TIL tested and one of the four TAL tested preferentially lysed autologous tumor. HER-2 peptide E75 (369-377) was recognized by two TIL lines of the five primary TIL tested and three of the four TAL tested. This suggests that E75 may be recognized by primary breast tumors. This may be of interest in developing vaccine strategies for therapeutic management of breast cancer.

Antigen-Antibody Reactions↗

Exposure-response functions in Air Force toxic risk modeling.

A new methodology for estimating the probabilistic risk from acute toxic exposures is planned as a support tool for the Air Force at the Eastern and Western Ranges. Two such methodologies are programs entitled the Launch Area Toxic Analysis program (LATRA) and the Cold Spill Toxic Risk Analysis program (COSTRA). These programs combine probabilistic models of an accident (when applicable), release cloud formation and dispersion (appropriate to the toxic substance and accounting for meteorological conditions), and new exposure-response functions (ERFs) for sensitive and normal exposed populations. These ERFs, anchored on specific exposure standards, estimate the probability of a given severity of health effect in a particular population as a function of the concentration or dose to which it is exposed. The further development and acceptance of these ERFs by the toxicology community, especially for different sensitivities, are key concerns addressed in this paper.

Accidents, Aviation↗

Wild-type p53 regulates its own transcription in a cell-type specific manner.

Wild-type (w.t.) p53 acts as a transcriptional regulator that binds to DNA and modulates transcription of several promoters. Wild-type p53 has also been shown to autoregulate its own transcription. There is no agreement, however, on whether w.t. p53 has trans-activates or downregulates its own transcription. To further explore the transcriptional autoregulation of the p53 gene, we analyzed the effect of w.t. p53 on its own promoter in different cell lines that do not express p53. A DNA domain within the human p53 promoter (-48 to -23) with the structure of ATGGGATTGGGGTTTTCCCCTCCCAT shares 8 of 10 nucleotides sequence homology with the p53 binding motif. When the human p53 promoter that included this domain was linked to a chloramphenicol acetyltransferase (CAT) gene and coexpressed with w.t. or mutated p53 in cells lacking p53 protein, w.t. p53 down-regulated its own promoter in SAOS-2 and K562 cells, but not in DP15 cells. We were unable to detect direct interaction of p53 with its promoter or to domain -48 to -23 following transfection of these cells with w.t. p53. A different pattern of protein--DNA complexes was observed, however, between the p53 promoter and nuclear extracts from SAOS-2 and DP15 cells following transfection with w.t. p53. These data suggest that w.t. p53 autoregulates its own promoter indirectly and in a cell type-specific manner.

Amino Acid Sequence↗

Changes in an HER-2 peptide upregulating HLA-A2 expression affect both conformational epitopes and CTL recognition: implications for optimization of antigen presentation and tumor-specific CTL induction.

The HER-2/neu protooncogene (HER-2) is overexpressed in a significant number of breast and ovarian tumors. Peptides of HER-2 sequence were recently found to reconstitute recognition of cytotoxic T lymphocytes (CTLs) from tumor-associated (TALs) and tumor-infiltrating (TILs) lymphocytes, indicating that they reconstitute natural epitopes recognized by CTLs on HLA-A2+ tumors. Because HER-2 is an important antigen (Ag) for tumor-specific CTL induction and the immunogenicity of peptides for CTL induction is dependent on their presentation as stable complexes with HLA-A2, we identified peptides of high and low stabilizing activity from the sequence of HER-2 and the folate-binding protein (FBP). Distinct sequence patterns in the region positions (P)3-P5 and P1 were found for peptides with high (HSA) and low (LSA) stabilizing ability. A low-HLA-A2-affinity HER-2 peptide, P1 of the CTL epitope, was found to be permissive to substitutions that enhanced HLA-A2-stabilizing ability and conserved CTL recognition. In contrast, the region P3-P5 was not permissive to sequence changes. We conclude that the selective permissivity of P1 and P9 in the tumor epitope sequence may have important implications for optimization of tumor Ag presentation, and "neoantigenicity" of self-antigens, aiming toward induction of tumor-reactive CTLs of defined affinity and specificity for target Ags.

Amino Acid Sequence↗

Effects of anions on the binding of the cAMP receptor protein to the lactose promoter.

The DNA binding affinities of several gene-regulatory proteins, restriction endonucleases and the Escherichia coli RNA polymerase have previously been found to be dependent on the nature of the dominant buffer anion. To discover whether the E. coli cAMP receptor protein (CAP) exhibits a similar dependency, we measured its affinity for its primary lactose promoter binding site (lac site 1) in buffers in which the principal anion was chloride, phosphate, sulfate, acetate, or glutamate. We found that the affinity of CAP for lac site 1 is affected only slightly by changes in the dominant buffer anion. The binding of cAMP is similarly insensitive to buffer anion type, indicating that specific protein-anion interactions, if they occur, must be similar for the free and cAMP-bound forms of the protein. The effect of anion substitution on the ability of acrylamide to quench the intrinsic fluorescence of tryptophanyl residues of CAP is also small, suggesting that changes in buffer anion composition have minimal effect on the conformation of tryptophan-proximal regions of CAP. This conclusion is extended by the finding that anion substitution has a relatively small effect on the urea-concentration dependence of CAP denaturation. Taken together, these results support the notion that neither CAP nor CAP.cAMP nor the CAP.cAMP complex with lac promoter DNA interact selectively with anions present in the surrounding buffer. A possible role for this anion-insensitivity in the in vivo function of CAP is suggested.

Anions↗

The binding of cyclic AMP receptor protein to two lactose promoter sites is not cooperative in vitro.

The lactose promoter-operator region of Escherichia coli contains two binding sites for cyclic AMP receptor protein (CAP), two for the lactose repressor, and two for RNA polymerase. The high density of binding sites makes cooperative interactions between these proteins likely. In this study, we used the gel electrophoresis mobility shift assay and binding partition analysis techniques to determine whether the secondary CAP site influences the binding of CAP to the principal CAP site in the lactose promoter when both are present on a linear DNA molecule. Such an effect could occur through the formation of a bridged DNA-CAP-DNA structure, through the interaction of CAP molecules bound to each of the sites, or through allosteric effects caused by CAP-mediated DNA bending. We found, however, that the interaction of CAP with these sites was not cooperative, indicating that CAP sites 1 and 2 bind CAP in an independent manner.

Base Sequence↗

Co-operative interactions between the catabolite gene activator protein and the lac repressor at the lactose promoter.

The catabolite gene activator protein (CAP) and the lac repressor regulate the transcriptional activity of the lactose operon. An early step in the regulatory functions of these proteins is their binding to specific DNA sequences within the lac promoter-operator region. Using the gel electrophoresis mobility-shift technique, we have found that the ternary complex with CAP and repressor bound to their respective highest affinity sites is 4 to 11-fold more stable than is predicted from the affinities of the independently bound proteins. This favorable binding interaction is unexpected, because CAP and lac repressor exert opposing effects on lac operon transcription. Deoxyribonuclease I footprinting analyses show that interacting proteins remain bound to the sites occupied when the proteins bind singly. These sites have a center-to-center separation of 72 base-pairs (corresponding to 6.9 turns of a B-form DNA helix), and thus occupy the same "face" of the DNA cylinder. Such an orientation is compatible with models of the ternary complex in which DNA curvature facilitates the interaction of CAP and lac repressor.

Base Sequence↗

A new DNA binding mode for CAP.

In the absence of cyclic AMP, the Escherichia coli cyclic AMP receptor protein (CAP) binds without detectable sequence specificity to restriction fragments containing lac and crp promoter sequences. Under standard conditions (10 mM Tris, 1 mM EDTA, pH 8.0), our estimates of the equilibrium constant and cooperativity parameter for complex formation are 114,000 +/- 1400 M-1 and 1.3 +/- 0.8, respectively. Thus, this interaction lacks the substantial cooperativity previously reported for CAP binding to genomic DNAs. Using the electrophoresis mobility shift assay, we find that complexes of increasing CAP content differ by a highly uniform mobility decrement. This result is most consistent with a binding mode in which little or no DNA bending occurs. The ability of CAP to distinguish between restriction fragments and genomic DNA, shown by the difference in binding cooperativity, suggests the existence of previously unsuspected DNA sequences or structures that modulate its binding cooperativity.

Binding Sites↗