Search PubMedSearch

Biomedical subjects

J L Betz

Publications and source records attributed to J L Betz.

At least 19 recordsLinked to original sources

Specific binding of lac repressor to linear versus circular polyoperator molecules.

Gel shift assays were used to examine the binding of the lactose (lac) repressor to polyoperator DNA molecules. Specific binding was differentiated from nonspecific DNA association by (i) equilibrating repressor-operator complexes below the nonspecific association constant and (ii) demonstrating the effects of the inducer isopropyl beta-D-thiogalactoside (IPTG) on the formation of repressor-operator complexes. With the linear polyoperator molecules, all eight operator sites could be simultaneously bound by distinct repressors. However, with circular molecules, the eight operator sites were saturable by repressor only in the nicked circular state and not in the covalently closed circular form. Under the experimental conditions used, there was no evidence of bifunctional repressor binding or loop formation. The results suggest that the conformational perturbation of DNA that occurs upon specific repressor binding was retained in topologically closed molecules and could modify other operator sites so as to make them unavailable for specific binding.

Bacterial Proteins

Symmetric lac operator derivatives: effects of half-operator sequence and spacing on repressor affinity.

We have analyzed lac repressor binding in vivo and in vitro to several symmetric lac operator sequences. Two features of the operator appear to be important for repressor binding: sequence, both of the operator and of its extended regions, and the spacing of the operator halves. Host mutations that alter DNA superhelical density (topA, gyrB) did not change the relative affinity of cloned symmetric operator sequences for repressor. Analysis by dimethylsulfate methylation and DNaseI digestion of repressor-operator complexes indicated that repressor makes symmetric contacts with the symmetric operator, in contrast to its contacts with the two halves of the natural operator.

Base Sequence

Effects of dominant-negative lac repressor mutations on operator specificity and protein stability.

The specific binding of dominant-negative (I-d) lactose (lac) repressors to wild-type (wt) as well as mutant (Oc) lac operators has been examined to explore the sequence-specific interaction of the lac repressor with its target. Mutant lacI genes encoding substitutions in the N-terminal 60 amino acids (aa) were cloned in a derivative of plasmid pBR322. Twelve of these lacI-d missense mutations were transferred from F'lac episomes using general genetic recombination and molecular cloning, and nine lacI missense mutations were recloned from M13-lacI phages [Mott et al., Nucl. Acids Res. 12 (1984) 4139-4152]. The mutant repressors were examined for polypeptide size and stability, for binding the inducer isopropyl-beta-D-thiogalactoside (IPTG), as well as binding to wt operator. The mutant repressors' affinities for wt operator ranged from undetectable to about 1% that of wt repressor, and the mutant repressors varied in transdominance against repressor expressed from a chromosomal lacIq gene. Six of the I-d repressors were partially degraded in vivo. All repressors bound IPTG with approximately the affinity of wt repressor. Repressors having significant affinity for wt operator or with substitutions in the presumed operator recognition helix (aa 17-25) were examined in vivo for their affinities for a series of single site Oc operators. Whereas the Gly-18-, Ser-18- and Leu-18-substituted repressors showed altered specificity for position 7 of the operator [Ebright, Proc. Natl. Acad. Sci. USA 83 (1986) 303-307], the His-18 repressor did not affect specificity. This result may be related to the greater side-chain length of histidine compared to the other amino acid substitutions.

Amino Acid Sequence

A mammalian cell line designed to test the mutagenic activity of anti-herpes nucleosides.

The herpes simplex virus (HSV) thymidine kinase (tk) gene was transfected into Chinese hamster ovary (CHO) 51-11 gly- cells to test its effect on the cytotoxic and mutagenic activity of anti-herpetic nucleoside analogues. Insertion of the viral tk was verified by Southern blot analysis, by sensitivity to acyclovir, and by elevated in vitro thymidine kinase (TK) activity. TK activity was increased by superinfection with a tk- virus and inhibited by antibody to viral TK. Acyclovir (ACV) was somewhat more cytotoxic in the 51-D3 cell line that expresses the viral TK than in the 51-11 parent line. Growth in ACV did not increase over background mutations at the hprt locus. FIAC (2'-fluoro-5-iodio-aracytosine) was slightly cytotoxic to the parent 51-11 line and the tk-containing clone 51-D3. FMAU (2'-fluoro-5-methyl-arauracil) had pronounced cytotoxicity in both cell lines: the 50% survival points were 1.0 microM for 51-11 cells and 0.2 microM for 51-D3. The clone 51-D3 was more sensitive than 51-11 to low concentrations of FIAU (2'-fluoro-5-iodo-arauracil), and when treated with FIAU 51-D3 had a mutation frequency to glycine independence 5 times greater than that of 51-11 cells. With both cell lines the mutation frequency at the hprt locus did not increase after growth in the presence of FIAC or FIAU. A 7-fold increase in mutation frequency at the hprt locus was detected after 51-D3 cells were grown with iododeoxyuridine. Trifluorothymidine was more toxic to 51-D3 than to 51-11 cells and increased the mutation frequency 2-fold. Cytosine-beta-D-arabinofuranoside showed no differential cytotoxicity on the two cell lines and did not increase the mutation frequency at the hprt locus.

Acyclovir

Affinities of tight-binding lactose repressors for wild-type and pseudo-operators.

Five tight-binding (Itb) mutants of the Escherichia coli lactose (lac) repressor have been characterized with regard to their non-specific affinity for DNA and their specific affinity for the wild-type operator and several sequence-altered (pseudo-) operators. Repressor-operator association rates were determined in the presence or absence of competitor DNA, dissociation rates of repressor from various DNA fragments were measured, and equilibrium competition for repressor binding was examined for several pseudo-operator DNAs. The mutant repressors exhibited increased non-specific affinity for DNA, and variable increases in affinity for sequence-altered operators. The known positions of amino acid substitutions for three of these Itb repressors support suggestions that residues 51 to 64 are important for operator recognition in addition to residues 1 to 50.

Amino Acid Sequence

Cloning and characterization of several dominant-negative and tight-binding mutants of lac repressor.

Using both general recombination and molecular cloning techniques, 13I-, I-d and Itb missense mutations in the lacI gene were transferred from F'lacIq episomes to ColE1 derivative plasmids. Two deletion derivatives of the lacI genes encoding the wild-type (wt) and the tight-binding (Itb) B3 and B5 repressors were also constructed. The mutant repressors were examined for polypeptide size and stability, and for binding to the inducer isopropyl-beta-D-thiogalactoside (IPTG). Several of the I-d repressors were shown to be partially degraded in vivo, in confirmation of earlier results based on [14C]IPTG binding [Miwa and Sadler, J. Mol. Biol. 117 (1977) 843-868]. The sizes of polypeptides produced by lacI deletion derivatives were consistent with expectations based on the extent of deletion and the location of termination sites within the plasmid sequence. The first 400 bp of several mutant lacI genes were sequenced. Our wt lacI gene differs from another wt lacI sequence (Farabaugh, 1978), containing a single bp change that results in an Ala to Thr substitution at amino acid (aa) 109. We identified bp substitutions and the resultant aa changes for two Itb and two I-d genes; the positions correlated with prior genetic mapping data. Three of these new changes were in the N-terminal domain (headpiece) of repressor, with one change in the core domain at aa 99.

Base Sequence

Base substitution mutants of the lac operator: in vivo and in vitro affinities for lac repressor.

16 single-site mutations and a 1-bp deletion in the lac operator have been cloned and examined with regard to repressor binding. A 13-bp, central 'core' operator sequence, bp 5-17 of the natural operator, was also synthesized and cloned. Repressor affinity was assessed in vivo by quantitating the level of beta-galactosidase activity resulting from chromosomal operon derepression and in vitro by measuring the stability of repressor-operator complexes. Our results support the general conclusion that the repressor-operator interaction is asymmetric, particularly across the center of the operator sequence, with little or no specific contact at position 12. Some sequence changes in the right side of the operator markedly reduced repressor affinity, indicating that although binding to this half of the sequence has been suggested to be less important than the left half, it still significantly contributes to the binding affinity.

Cloning, Molecular

Regulation of transcription in vitro from herpes simplex virus genes.

In vitro transcription assays were carried out by using as templates DNAs cut from the herpes simplex virus early glycoprotein D gene, the late glycoprotein C gene, the late VP5 gene, and the immediate-early ICP22 gene. Nuclear extracts from suspension cultures of uninfected HeLa cells effectively synthesized RNAs from genes of the immediate-early and delayed-early classes. To a lesser extent, the extracts also used DNAs cut from the late genes as templates. Transcription from the immediate-early gene was inhibited in extracts prepared from infected cells. Analysis of the proteins in infected-cell extracts by gel electrophoresis, transfer to nitrocellulose, and probing with specific antibody demonstrated the presence of the viral regulatory protein ICP4. Chromatographic fractionation of nuclear extract from infected cells yielded a mixture of proteins (fraction VIII) enriched in ICP4 (S.W. Faber and K.W. Wilcox, Nucleic Acids Res., 14:6067-6083, 1986). Addition of fraction VIII to the in vitro assay affected transcription. Depending on the DNA in the assay, an inhibitory or stimulatory effect was observed. Inhibition of RNA synthesis was found when DNA from the immediate-early gene was used as a template, and stimulation was found when DNA from the early or late gene was used.

Capsid

Virion component of herpes simplex virus type 1 KOS interferes with early shutoff of host protein synthesis induced by herpes simplex virus type 2 186.

Herpes simplex virus (HSV) strains HSV type 1 (HSV-1) KOS and HSV-2 186 are representative of delayed and early shutoff strains, respectively, with regard to their ability to inhibit protein synthesis in Friend erythroleukemia cells. When these cells were simultaneously infected with HSV-1 KOS and HSV-2 186, HSV-1 KOS interfered with the rapid suppression of globin synthesis induced by HSV-2 186. The observed interference was competitive and not due to exclusion of HSV-2 by HSV-1 at the level of adsorption. Furthermore, UV-irradiated HSV-1 KOS was also effective at interfering with the early shutoff function of HSV-2 186, indicating that a virion component is responsible for the observed interference.

Animals

Regulated high-level expression of the Herpes simplex type I thymidine kinase gene in Escherichia coli.

A plasmid-borne Herpes simplex virus type 1 (HSV-1) thymidine kinase (TK) gene (tk) was expressed in Escherichia coli by inserting a 203-bp lacL8/UV5 promoter-operator segment, in frame, 53 bp 5' to the native tk translational start codon. The hybrid gene created by this fusion encodes a polypeptide which has 25 additional amino acids on the amino terminus of the HSV-1 TK protein and phenotypically complements a tdk- mutation of E. coli. This fusion polypeptide has been characterized by maxicell, immunoprecipitation, and native gel techniques, and its activity is inhibited by anti-HSV-1 antibody. In a tk expressor strain containing a F' lacIq (which overproduces the lactose repressor), the isopropyl-beta-D-thiogalactoside (IPTG) causes greater than 1000-fold coordinate induction of the plasmid-encoded TK and chromosomal beta-galactosidase activities. Pulse-chase induction demonstrates the fused TK polypeptide to be as stable as beta-galactosidase. HSV-1 tk-specific RNA isolated from this bacterial strain has a short half-life characteristic of bacterial messages.

Cloning, Molecular

A perfectly symmetric lac operator binds the lac repressor very tightly.

A completely symmetric DNA segment has been constructed that binds the lactose repressor of Escherichia coli 10-fold more tightly than does the natural lactose operator sequence. This tight-binding operator is an inverted repeat of a 15-base-pair segment from the left half of the natural operator sequence, the inversion being about the point indicated by the arrow shown below: (sequence in text) where the upper sequence is the natural operator and the lower sequence is the symmetric operator. The increased affinity of repressor for this symmetric sequence supports the idea that the tetrameric repressor is designed for a two-module binding to DNA, presumably via two (or two pairs) of its identical subunits. The natural operator is apparently "flawed" by "incorrect" base pairs in the right operator half and by an "incorrect" spacing between the operator halves with respect to maximal repressor binding.

Base Sequence

Transcription from the BamHI J fragment of herpes simplex virus type 1 (KOS).

RNA transfer experiments (Northern analyses) were used to localize polyadenylated mRNA species made after herpes simplex virus type 1 infection to EcoRI and BamHI fragments and subfragments from the short unique region of the herpes simplex virus type 1 (KOS) genome. Three predominant early mRNAs of 2.5, 1.3, and 0.9 kilobases map in the BamHI J fragment. A detailed restriction map of the BamHI J fragment was constructed.

Cell Line

RNAs transcribed from a 3.6-kilobase SmaI fragment of the short unique region of the herpes simplex virus type 1 genome.

A 3.6-kilobase (kb) SmaI subclone of the BamHI J fragment of herpes simplex virus type 1 (KOS) DNA was utilized to characterize the mRNAs transcribed from the genome segment (0.91 to 0.93 map units) that encodes glycoprotein D mRNA. RNA blotting demonstrated two major RNA species of 2.3 and 1.5 kb. 5' and 3' mapping with 32P-end-labeled DNA fragments indicated that these RNAs are a nested set, each having its own promoter and 3' terminus. Less abundant RNA species with discrete 5' ends were also observed. Precise 5' mapping and sequence data located the initiation sites and demonstrated TATA boxes, CAT boxes, and AC-rich regions in the appropriate positions. 3' mapping located a common end for both mRNAs, but the 2.3-kb mRNA was reduced in size by splicing at a point near the RNA terminus. In vitro runoff transcription experiments confirmed the location of the two promoters and showed that an uninfected cell extract initiated faithfully at both sites. Despite the similarities in DNA structure and the apparent equal efficiency of promoter utilization in vitro, the 2.3-kb mRNA appeared in the cytoplasm early (1 h) after infection, whereas the 1.5-kb mRNA was delayed until 3 h after infection.

Base Sequence

Determination of the ligand-binding characteristics of several tight-binding mutants of the lactose repressor protein.

Several tight-binding mutants of the lactose repressor protein have been characterized with respect to their fluorescence properties and their inducer, operator and nonspecific DNA-binding constants. The tryptophan fluorescence emission spectra for the mutants and the wild-type repressor are quite similar. However, alterations in the Stern-Volmer constants for iodide quenching of the tryptophans in the mutant proteins compared to wild-type suggest differences in the local environment or solvent accessibility for these amino acids in the tight-binding repressors. The inducer-binding affinities and association rate constants of the mutant proteins and protein-operator DNA fragment complexes are also altered compared to wild-type. The extents of these changes vary among the different mutant repressors. The nonspecific DNA-binding affinities of the mutant proteins are 2--3-fold greater than the wild-type repressor, and the affinities of the tight-binding proteins for a 29 base-pair operator DNA fragment are also increased, though to a varying extent depending upon the mutant. The phenotypic behavior of these proteins in vivo can be partially explained by these results obtained in vitro; however, it is likely that there are additional factors responsible for the tight-binding behavior of the proteins that were not detectable in these experiments.

Alleles

Plasmids containing many tandem copies of a synthetic lactose operator.

Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.

Base Sequence

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.

Base Sequence

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.

Coliphages