Search PubMed⌕ Search

Biomedical subjects

J Johnson

Publications and source records attributed to J Johnson.

At least 235 records · Page 13Linked to original sources
PubMed1996

The involvement of p23, hsp90, and immunophilins in the assembly of progesterone receptor complexes.

To better understand the assembly mechanism for the progesterone receptor (PR), we have developed cell-free systems for studying interactions of PR, hsp90, and other associated proteins. When PR is incubated in rabbit reticulocyte lysate, its association with hsp90, hsp70, the three immunophilins FKBP54, FKBP52 and CyP-40, and with p23 is observed. These interactions require ATP/Mg2+ and when ATP is limiting the PR complex is altered to one containing the proteins p60 and p48, but lacking immunophilins and p23. We have studied two pre-formed hsp90 complexes that may participate in the assembly of PR complexes. One contains hsp90 bound to hsp70 and p60 and this complex forms spontaneously in the absence of ATP. A second complex contains hsp90 bound to p23 plus the three immunophilins and some hsp70. The formation of this complex requires ATP. In further studies we have shown that purified hsp90 can bind to purified p23 and this interaction requires both ATP and molybdate. This explains, in part, the known effects of ATP and molybdate on assembly of PR complexes.

Adenosine Triphosphate↗
PubMed1996

The role of fetal karyotyping from unconventional sources.

OBJECTIVE: Our purpose was to determine whether fetal specimens, including pleural, ascitic, pericardial, facial, and cystic hygroma fluid or urine, are suitable sources for accurate chromosomal analysis. STUDY DESIGN: Thirty-nine samples of fetal fluid (pleural, n = 11; ascitic, n = 5; pericardial, n = 1; lung cyst, n = 1, facial cyst, n = 1; cystic hygroma, n = 7; and urine, n = 13) were cultured and analyzed with standard cytogenetic techniques for lymphocytes or amniotic fluid. These samples were obtained as part of the routine obstetric investigation and management. Conventional backup samples were also obtained. RESULTS: Karyotyping was successful in 34 of 39 samples. Cells were harvested from all pleural samples, three ascitic samples, and one hygroma fluid sample in 2 to 4 days from 11 urine samples, one ascitic sample, and the remaining six hygroma samples in 7 to 11 days. Five cultures were unsuccessful. Samples with high lymphocyte counts yielded results as quickly as fetal blood. CONCLUSION: The use of "alternative" samples of fetal fluids for karyotyping may be considered when amniotic fluid or fetal blood is difficult to obtain. In selected cases this approach avoids the unnecessary risk of additional invasive procedures solely to obtain a karyotype.

Ascitic Fluid↗
PubMed1996

Trial of isotretinoin and calcitriol monitored by CA 125 in patients with ovarian cancer.

Twenty-two asymptomatic women with rising CA 125 levels after chemotherapy for ovarian cancer were entered into a trial of isotretinoin combined with calcitriol. Tumours were evaluated according to precise criteria based on serial CA 125 levels and by comparing regression slopes of CA 125 before and during therapy. There was no evidence based on CA 125 of any responses or significant change in tumour growth rate.

Antineoplastic Combined Chemotherapy Protocols↗
PubMed1996

Glandular lesions of the cervix-cytological and histological correlation.

In this retrospective review we assessed the frequency with which atypical glandular cells in cervical smears predict cervical glandular lesions. Asymptomatic patients (n=34) with one or more smears showing atypical glandular cells aand subsequent histopathological assessment were studied. Independent cytological and histological review was undertaken. Cytological review confirmed atypical glandular cells in 29 cases, 17 of which had coexisting squamous dyskaryosis. Histological review of these 29 cases revealed glandular neoplasia in 13 (45%) and microglandular hyperplasia (MEH) in an additional four (14%). Initial reporting had underestimated the prevalence of glandular neoplasia.

Adenocarcinoma↗
PubMed1996

The cold sensitivity of a mutant of Saccharomyces cerevisiae lacking a mitochondrial heat shock protein 70 is suppressed by loss of mitochondrial DNA.

SSH1, a newly identified member of the heat shock protein (hsp70) multigene family of the budding yeast Saccharomyces cerevisiae, encodes a protein localized to the mitochondrial matrix. Deletion of the SSH1 gene results in extremely slow growth at 23 degrees C or 30 degrees C, but nearly wild-type growth at 37 degrees C. The matrix of the mitochondria contains another hsp70, Ssc1, which is essential for growth and required for translocation of proteins into mitochondria. Unlike SSC1 mutants, an SSH1 mutant showed no detectable defects in import of several proteins from the cytosol to the matrix compared to wild type. Increased expression of Ssc1 partially suppressed the cold-sensitive growth defect of the SSH1 mutant, suggesting that when present in increased amounts, Ssc1 can at least partially carry out the normal functions of Ssh1. Spontaneous suppressors of the cold-sensitive phenotype of an SSH1 null mutant were obtained at a high frequency at 23 degrees C, and were all found to be respiration deficient. 15 of 16 suppressors that were analyzed lacked mitochondrial DNA, while the 16th had reduced amounts. We suggest that Ssh1 is required for normal mitochondrial DNA replication, and that disruption of this process in ssh1 cells results in a defect in mitochondrial function at low temperatures.

Amino Acid Sequence↗
PubMed1996

HIV-1 RNA levels and the development of clinical disease. North American Lamivudine HIV Working Group.

OBJECTIVE: To assess the prognostic value of HIV RNA levels for predicting clinical disease independently of the CD4 lymphocyte count in patients on antiretroviral therapy. DESIGN: Cohort of HIV-infected patients from two trials of lamivudine therapy. PATIENTS: For 620 patients randomized in the North American NUCA3001 and NUCA3002 trials of lamivudine, HIV RNA levels were measured (median, seven measures per patient) and CD4 counts were assessed at a central laboratory (median, 13 counts per patient). Patients were in the 1993 Centers for Disease Control and Prevention (CDC) stages A (n = 439), B (n = 135) or C (n = 46) at baseline. OUTCOME MEASURES: For patients who were in CDC stage A at baseline we considered the ability of HIV RNA levels and CD4 counts to predict the development of CDC stage B or C disease. A Cox proportional hazards model was used. In a second analysis, patients who were AIDS-free at baseline were considered, and the endpoint was AIDS (CDC stage C). RESULTS: Patients' initial CD4 counts ranged (5-95% centiles) from 104 to 529 x 10(6)/l (median, 274 x 10(6)/l) and HIV RNA levels from 1900 to 339680 copies/ml (median, 44240 copies/ml). For the first analysis, with CDC stage B or C disease as endpoint, both the most recent HIV RNA level and CD4 count predicted the development of clinical disease [relative hazard (RH) for HIV RNA, 1.96 per 10-fold difference in HIV RNA; 95% confidence interval (CI), 1.41-2.73; P = 0.0001; and RH for CD4 count, 1.82 per twofold difference in CD4 count; 95% CI, 1.27-2.56; P = 0.0009]. When both HIV RNA and CD4 count were included in a multiple regression model, both markers provided information additional to that given by the other (RH for HIV RNA, 1.75; 95% CI, 1.23-2.50; P = 0.002; and RH for CD4 count, 1.40; 95% CI, 0.95-2.07; P = 0.09). In the second analysis, with AIDS as endpoint, both HIV RNA level (P = 0.02) and CD4 count (P = 0.004) were independently associated with clinical progression. These results were essentially unchanged after adjustment for treatment arm (zidovudine/lamivudine versus control arms). CONCLUSION: The HIV RNA level shows ability to predict the development of clinical disease and may thus be of importance in addition to the CD4 count in patient monitoring.

Adult↗
PubMed1996

An uncommon presentation of Salmonella.

Salmonella infection can cause appendicitis by direct invasion of the appendix, or can mimic appendicitis by causing mild inflammation of the appendix, ileum, or lymph nodes. Clinical presentation and radiologic and laboratory evaluation may not distinguish the extent of underlying pathology. This case of a child with an atypical presentation of Salmonella who underwent diagnostic laparotomy illustrates the overlap of enteric infections and acute appendicitis. A literature review confirms the variety of clinical scenarios of patients with suspected appendicitis and Salmonella-positive cultures. We conclude that enteric infection should be considered in children with atypical presentations of appendicitis, and that the knowledge that Salmonella can progress to appendicitis should guide management if signs and symptoms of appendicitis develop.

Adolescent↗
PubMed1996

Developing culturally sensitive HIV/AIDS and substance abuse prevention curricula for Native American youth.

In 1990, researchers and health care professionals joined with members of several southwestern Native American communities to form an HIV/AIDS and substance abuse prevention partnership. Culturally sensitive approaches to theory-based interventions were developed into highly replicable, structured, school-based and community-based intervention programs. Process evaluations indicated high levels of program acceptance and fidelity. Outcome evaluations demonstrated significant positive preventive intervention effects among participants. This article reports how NAPPASA school prevention curricula were developed and discusses three critical processes in developing these successful curricula: 1) selection of integrative theory to address the multi-dimensional antecedents of HIV/AIDS and substance abuse among Native Americans, 2) use of ethnographic methodology to obtain intensive input from target groups and community members to ensure cultural and developmental sensitivity in the curriculum, and 3) use of process and outcome evaluations of pilot and field trials to develop an optimal curriculum.

Adolescent↗
PubMed1996

Screening protocol for Torulopsis (Candida) glabrata.

A screening test has been developed for the presumptive identification of Torulopsis (Candida) glabrata from other common clinical isolates of yeast-like fungi. An interlaboratory comparison of a protocol consisting of morphology on cornmeal Tween 80 agar and trehalose fermentation at 42 degrees C was successful in differentiating T. glabrata from other taxa that are frequent or possible clinical isolates. The screening results for 517 clinical yeast isolates, 241 of which were T. glabrata, were compared with their final identification via commercial systems (API20C Yeast Identification System [bioMERIEUX, Hazelwood, Mo.] and Rapid Yeast Identification Panel [Dade Microscan, Sacramento, Calif.]). The trehalose screening test has a sensitivity and a specificity of 97.8 and 95.8%, respectively, and a positive predictive value of 97.4% and a negative predictive value of 96.5%. Overall, the trehalose screen had an efficiency rating of 93.9% for ruling in or out T. glabrata. Since T. glabrata represents a substantial part of the workload in a clinical laboratory, a significant reduction in direct and indirect costs should be realized.

Candida↗
PubMed1996

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.

Base Sequence↗
PubMed1996

Predictors of survival in human immunodeficiency virus-infected patients with pulmonary tuberculosis. The Makerere University-Case Western Reserve University Research Collaboration.

Infection with the human immunodeficiency virus (HIV) has changed both the epidemiology and natural history of tuberculosis. Despite a generally good response to effective antituberculous therapy, the prognosis remains poor. The objective of this analysis was to determine the independent predictors of survival in HIV-infected Ugandan adults with smear-positive pulmonary tuberculosis. A total of 191 HIV-infected Ugandan adults with smear-positive pulmonary tuberculosis were enrolled into a clinical trial of chemotherapy for tuberculosis. The subjects received either rifampin, isoniazid, and pyrazinamide for two months, followed by rifampin and isoniazid for six months (n = 101) or streptomycin, thiacetazone, and isoniazid for two months followed by thiacetazone and isoniazid for eight months (n = 90). After standard measurements were made at baseline, the group was followed at regular intervals for a mean of 16 months to determine survival. During the course of follow-up, 82 (43%) of the patients died, six within the first month of therapy. The one-year survival proportion was 68% with an estimated median survival of 26 months and did not differ according to treatment regimen. The hazard for death was biphasic, high early in the course of therapy, and then again after about one year. After controlling for the treatment regimen, four independent predictors of survival were found: anergy to purified protein derivative, atypical chest roentgenogram, previous HIV-related condition, and lymphopenia. In this cohort of Ugandan adults, four simple and inexpensive predictors of survival were found. These factors suggest that the degree of immunosuppression was a major determinant of survival.

AIDS-Related Opportunistic Infections↗
PubMed1996

Neurodegenerative diseases: occupational occurrence and potential risk factors, 1982 through 1991.

OBJECTIVES: To identify potential occupational risk factors, this study examined the occupational occurrence of various neurodegenerative diseases. METHODS: Death certificates from 27 states in the National Occupational Mortality Surveillance System were evaluated for 1982 to 1991. Proportionate mortality ratios were calculated by occupation for presenile dementia, Alzheimer's disease, Parkinson's disease, and motor neuron disease. RESULTS: Excess mortality was observed for all four categories in the following occupational categories: teachers; medical personnel; machinists and machine operators; scientists; writers/designers/entertainers; and support and clerical workers. Clusters of three neurodegenerative diseases were also found in occupations involving pesticides, solvents, and electromagnetic fields and in legal, library, social, and religious work. Early death from motor neuron disease was found for firefighters, janitors, military personnel, teachers, excavation machine operators, and veterinarians, among others. CONCLUSIONS: Neurodegenerative disease occurs more frequently in some occupations than in others, and this distribution, which may indicate occupational risk factors, should be further investigated.

Black or African American↗
PubMed1996

Laparoscopic cholecystectomy in the geriatric population.

Although the role of laparoscopic cholecystectomy (LC) as a safe and cost effective procedure has been ascertained, its role in the geriatric population, the majority of whom present with coexistent diseases, has yet to be defined. We retrospectively reviewed outcome parameters of 144 consecutive patients over age 65 undergoing LC, for both acute cholecystitis and symptomatic cholelithiasis. These results were compared with 72 patients having open cholecystectomy (OC) during the same time period and in the year preceding the introduction of LC. Groups were well matched with respect to age, age distribution indication for surgery, and underlying comorbid illnesses. Of those with symptomatic cholelithiasis, LC did not prolong operative time when compared with OC, but resulted in significantly earlier discharge (1.8 +/- 2.9 vs. 6.7 +/- 5.7 days (P < 0.0001)), with comparable hospital costs and with no increase in postoperative complications. With respect to acute cholecystitis, LC significantly prolonged operative time (105.8 +/- 40.8 vs. 78.1 +/- 28.5 minutes (P < 0.05)), but when successful, significantly reduced postoperative stay (4.2 +/- 3.8 vs. 7.5 +/- 2.3 days (P < 0.05)). There was no increase in postoperative complications in those having LC, and hospital costs were comparable with OC. Seven patients were converted from LC to OC; 4 of these (16%) were for acute cholecystitis versus a 2.5 per cent incidence of conversion for symptomatic cholelithiasis, and these resulted in prolonged hospital stays and costs. There was no incidence of hypotension/hypercarbia, despite a 64 per cent incidence of cardiopulmonary cardiopulmonary diseases in those having LC. There was a 14 per cent incidence of cardiopulmonary complications in those having LC in contrast to a 43 per cent incidence in OC. LC in the geriatric population is a safe procedure for symptomatic cholelithiasis. The procedure should be undertaken with caution in those with acute cholecystitis with a low threshold for either early conversion or primary OC. Finally, our results suggest that extensive hemodynamic monitoring is not indicated.

Acute Disease↗
PubMed1996

Deep venous thrombosis prophylaxis with low molecular weight heparin and elastic compression in patients having total hip replacement. A randomised controlled trial.

Seventy-eight patients having elective total hip replacement were randomised into 3 groups A) control; B) low molecular weight heparin: (enoxaparin 40 mg once daily) and C) enoxaparin (40 mg once daily) plus graduated elastic compression (TEDR stockings) for 8-12 days. All patients had a preoperative perfusion lung scan and chest X-Ray and a postoperative perfusion/ventilation scan together with bilateral ascending venography on days 8-12. A blood sample was taken preoperatively, on the 1st, 3rd and 5th postoperative day and at the end of the study. The control group received placebo injections. The venograms and V/Q scans were reported blindly by an independent panel of three and one radiologists respectively. An independent panel of assessors stopped entry in the control group when a total of 45 patients were admitted according to Ethics Committee directives. The study continued with groups B and C. The incidence of DVT (including isolated asymptomatic calf thrombi) was as follows: Group A (n = 14) 93%; Group B (n = 32) 38%; Group C (n = 32) 25% (chi 2; p < 0.001 for group A versus B or C). The incidence of proximal DVT was: Group A 57%; group B 28%; group C 13% (chi 2; p = 0.057 for group A versus B and p < 0.005 for group A versus C). The incidence of silent pulmonary embolism (PE) (new defect on V/Q scan) was 28% (8 out of 29) in patients with and 5% (2 out of 43) in patients without DVT (chi 2; p < 0.02). The combination of high TAT and low anti-Xa activity on the 1st postoperative day identified a high risk group of patients who had a 56% incidence of proximal DVT on the 8th to 12th postoperative day. Further studies are needed to confirm the suggested increased efficacy in prophylaxis by the combination of LMWH and GEC as compared with LMWH alone.

Aged↗
PubMed1996

A potential role for cell cycle control proteins in regulation of the cyclic adenosine 5'-monophosphate-responsive glycoprotein hormone alpha subunit gene.

The production of chorionic gonadotropin is coupled to the differentiation of the placenta. Expression of the alpha subunit of chorionic gonadotropin [glycoprotein hormone alpha (GPH-alpha)] is also known to be stimulated by treatment of placental cells with either cAMP or DNA synthesis inhibitors. Given these features, we used adenovirus E1A as a molecular probe to investigate a potential role for cell cycle regulatory proteins and kinases in the regulation of GPH-alpha expression. The E1A protein contains well-characterized domains that interact with a variety of cell cycle regulatory proteins. The E1A conserved regions 1 and 2 bind proteins that regulate cell cycle progression, including pRB, p107, and p130. The amino-terminal region of E1A binds several high molecular weight proteins and inhibits the transcriptional coactivator function of p300 and the homologous cAMP response element (CRE)-binding protein. We found that coexpression of E1A13S activated the GPH-alpha promoter, whereas E1A12S caused marked repression. Deletion mutants and point mutations revealed that repression by E1A12S required the CRE of the GPH-alpha promoter. Several distinct domains in E1A12S were necessary for maximal repression. A mutation of the E1A amino terminus (RG2), which inhibits binding of p300 and related high molecular weight proteins, reduced 12S repression by 40%. Mutation of the pocket protein-binding domains reduced repression by 20%, and mutations of both domains reduced repression by 80%. Overexpression of p300 or the pocket proteins (pRB, p130, and p107) induced GPH-alpha promoter activity 2-4-fold. Because the E1A amino terminus and pocket protein-binding domains together induce p34cdc2 kinase activity, the effect of p34cdc2 kinase expression on GPH-alpha activity was also assessed. Coexpression of p34cdc2 kinase or the activating p34cdc2 kinase mutant (T14AY15F) inhibited GPH-alpha promoter activity and acted through the CRE. We conclude that the GPH-alpha gene CRE is subject to regulation by cell cycle regulatory kinases and proteins.

Adenoviridae↗