Search PubMed⌕ Search

Biomedical subjects

J Hay

Publications and source records attributed to J Hay.

At least 181 records · Page 10Linked to original sources
PubMed1986

Experimental toxocariasis and hyperactivity in mice.

An observational study using videorecordings and computer-assisted data analysis was undertaken in order to investigate the behaviour of mice infected with larvae of Toxocara canis. The findings indicated that the infection had a marked effect on five readily and reliably differentiable categories of murine behaviour. A marked increase in the number of shorter bouts of each of the five behaviours was also associated with the infection. These results support previous findings and further suggest that T. canis infection affects the way in which mice respond to their environment. In particular the infection appears to be associated with hyperactivity in mice. Possible causes of such behavioural abnormalities as well as implications of these findings for clinical studies concerned with relationships between T. canis infection and hyperactivity in children are discussed.

Animals↗
PubMed1986

Clinicopathological features of a congenital murine model of ocular toxoplasmosis.

Sequential clinical examination was carried out upon the eyes of mice that had been infected in utero with Toxoplasma gondii. Three patterns of clinical disease were seen. First, crystalliform cataracts, which either remained unchanged in character or occasionally became more extensive, were observed. Second, acute uveitis occurred in a small proportion of eyes, progressing into a chronic inflammatory disease with secondary opaque cataract. The third pattern comprised multiple discrete foci of deep retinal disturbance. It is suggested that these lesions were attributable to focal macrophage clusters in the sub-retinal space with overlying dome-shaped elevations of the photoreceptor matrix. The severity of disease, as assessed clinically, correlated with the underlying histopathology but not with the serological titres against Toxoplasma. Immunocytochemical staining for Toxoplasma antigen revealed only intra-retinal Toxoplasma cysts, but no free organisms or extracystic antigen were demonstrated. Selective photoreceptor destruction was the most prominent histopathological feature, implicating auto-immune mechanisms of tissue destruction.

Acute Disease↗
PubMed1986

Coding strategy of the S genome segment of Hantaan virus.

Hantaan virus is the type species of the recently recognized Hantavirus genus of Bunyaviridae. The small (S) RNA segment of the negative-sense, tripartite genome was molecularly cloned and the nucleotide sequence was determined. The RNA sequence derived from the cDNA copy was found to contain 1696 nucleotides. A single open reading frame of sufficient size to encode the virus nucleocapsid protein was detected in the cDNA corresponding to viral complementary-sense RNA. RNA transcripts of the cDNA were synthesized with SP6 polymerase and were used to program cell-free reticulocyte lysate translation systems. Viral complementary-sense transcripts served as efficient messages in translation systems and generated Hantaan nucleocapsid protein. No translation products were detected when lysates were programmed with viral-sense transcripts. This coding assignment of the nucleocapsid protein to the viral complementary-sense RNA of the S genome segment is consistent with those of other members of this family. Unlike other Bunyaviridae, which encode both a nucleocapsid protein and a nonstructural (NSs) protein of similar sizes, a NSs protein has not been identified for Hantaan virus. Furthermore, other than the nucleocapsid protein gene sequence, the only potential open reading frame in Hantaan S RNA encoded a short, 48-amino acid polypeptide which initiated two codons beyond the termination of the nucleocapsid protein in the same reading frame. These data demonstrate that the coding strategy of the Hantaan virus S RNA is different than those reported for other viruses in this family.

Amino Acid Sequence↗
PubMed1986

The ultrastructural pathology of congenital murine toxoplasmic retinochoroiditis. Part I: The localization and morphology of Toxoplasma cysts in the retina.

This study describes the ultrastructural characteristics of retinal parasitization by Toxoplasma gondii in a congenital mouse model. Forty-two eyes from infected mice, 18-22-weeks-old, and 24 control eyes were initially studied by light microscopy of semithin sections. Twenty-six eyes from infected animals and six from the controls were further investigated by transmission electron microscopy. A total of 13 Toxoplasma cysts was found in samples of the retinas of six eyes from five infected animals. These were located in the inner retina, particularly the ganglion-cell layer, but in no other ocular tissue. The cyst wall interdigitated with the host cell which in most cases was probably glial in origin (Müller cell). Two cysts showed evidence of parasitization of neural cells. The individual Toxoplasma cystozoites demonstrated characteristic ultrastructural features. There was no evidence of morphological changes indicative of toxicity to surrounding retinal tissues, and the associated inflammatory cell reaction (described in Dutton, McMenamin, Hay and Cameron, 1986b) was remote from the parasite. There was no morphological evidence of rupture or degeneration of cysts. No free parasites (endozoites) or pseudocysts were observed.

Animals↗
PubMed1986

The ultrastructural pathology of congenital murine toxoplasmic retinochoroiditis. Part II: The morphology of the inflammatory changes.

A congenital murine model of toxoplasmic retinochoroiditis was employed to study the ultrastructural pathology of retinal parasitization by Toxoplasma gondii. Forty-two eyes from infected mice (18-22-weeks-old) and 24 eyes from control animals were studied by light microscopy (semithin sections). Twenty-six of the eyes from infected animals and six from the control group were subsequently selected for transmission electron microscopy. Control tissues showed no significant abnormality. The pathological changes in diseased tissues ranged in severity from low-grade mononuclear cell infiltration in the subretinal space to complete destruction of the outer retina, the retinal pigment epithelium and the choroid in the presence of a granulomatous inflammatory reaction. Phagocytosis of photoreceptor outer segments by macrophages was observed. Both macrophages and lymphocytes appeared to mediate photoreceptor lysis in eyes which were moderately affected by the disease. Severely affected eyes exhibited vasculitis and inflammatory cell invasion into the vitreous. A lymphoplasmacytoid cell infiltrate was present in the outer retina and choroid in these eyes. There was no evidence that Toxoplasma cysts provided foci for inflammatory cell attack.

Animals↗
PubMed1986

Toxocara canis infection and hyperactivity.

An observational study using video recordings and computer assisted data analysis showed that infection with Toxocara canis larvae had a marked effect on five readily and reliably differentiable categories of murine behaviour. The infection was also associated with an increase in the number of shorter bouts of each behavior. These results indicate that infection with T. canis renders mice hyperactive, and would appear to justify a complete reappraisal of the role of this neurotropic parasite as a cause of behavioural abnormalities such as hyperactivity in children.

Animals↗
PubMed1986

Hexavalent capsomers of herpes simplex virus type 2: symmetry, shape, dimensions, and oligomeric status.

The structures of the hexavalent capsomers of herpes simplex virus type 2 were analyzed by negative staining electron microscopy of capsomer patches derived from partially disrupted nucleocapsids. Optimally computer-averaged images were formed for each of the three classes of capsomer distinguished by their respective positions on the surface of the icosahedral capsid with a triangulation number of 16; in projection, each capsomer exhibited unequivocal sixfold symmetry. According to correspondence analysis of our set of capsomer images, no significant structural differences were detected among the three classes of capsomers, as visualized under these conditions. Taking into account information from images of freeze-dried, platinum-shadowed nucleocapsid fragments, it was established that each hexavalent capsomer is a hexamer of the 155-kilodalton major capsid protein. The capsomer has the form of a sixfold hollow cone approximately 12 nm in diameter and approximately 15 nm in depth, whose axial channel tapers in width from the outside towards the inner capsid surface.

Capsid↗
PubMed1986

Putative glycoprotein gene of varicella-zoster virus with variable copy numbers of a 42-base-pair repeat sequence has homology to herpes simplex virus glycoprotein C.

A strain variation of varicella-zoster virus that maps to the UL region of the genome was found to be due to different copy numbers of a high GC 42-base-pair repeat. DNA sequence analysis of this variable region showed the sequence to be 5-GCGGGATCGGGCTTTCGGG(A/T)AGCGGCCGAGGTGGGCGCGACG-3. Strains Scott and Webster both contain 7 and 32/42 copies of the repeat, whereas strain Oka has exactly 4 copies less. Microheterogeneity exists within the repeated sequences, depending on the strain and the repeat number. Sequencing of the entire EcoRI P fragment (which contains the repeated sequences) and part of the adjacent EcoRI M and EcoRI Q fragments from strain Scott showed that the repeats are part of a large open reading frame that could code for a polypeptide core with a molecular weight of 66,000. Several potential TATA boxes exist upstream and two polyadenylation signals are found downstream of the open reading frame. The predicted protein bears several characteristics of a glycoprotein. The region is transcriptionally active in varicella-zoster virus-infected cells, specifying at least three RNA species of 1.7, 1.95, and 2.5 kilobases, which are transcribed from the same DNA strand. Part of the predicted protein has a high degree of homology to the herpes simplex virus type 1 glycoprotein gC.

Amino Acid Sequence↗
PubMed1985

The effect of 2'-fluoro-2'-deoxycytidine on herpes virus growth.

The effect of 2'-fluoro-2'-deoxycytidine (dCfl) on the growth of certain viruses of the herpes type was investigated. It is shown that the compound has considerable anti-viral activity against HSV-I, HSV-II, pseudorabies virus and equine abortion virus. It has an effect comparable to that of araC and is more efficient than br5dC, but less so than acyclovir. Experiments with thymidine kinase-negative strains of HSV-I indicated that dCfl was phosphorylated by the viral kinase, and its Km appears to be low and close to that of thymidine. Density gradient centrifugation enabled us to show that dCfl was incorporated into cellular and viral DNA and RNA. The cytotoxic activity of dCfl appears to be about 10-times smaller than that of araC. Removal of the nucleoside analog, washing and replacement with deoxycytidine reversed this effect, indicating rather a cytostatic than cytotoxic effect.

Animals↗
PubMed1985

The influence of congenital Toxoplasma infection on the spontaneous running activity of mice.

Home-cage running-wheel activity of mice congenitally infected with Toxoplasma was recorded over 24 days. Infected mice were consistently more active than uninfected controls over the entire testing period. This finding extends previous studies and indicates that such increased activity levels occur not only in novel but also in familiar environments, and suggests that congenital toxoplasmosis tends to render mice "hyperactive'. If such behavioural alterations occur in wild mice, it is likely that infected mouse intermediate hosts would be more susceptible to predation by cats, the definitive hosts of Toxoplasma.

Animals↗
PubMed1985

Congenital toxoplasmic retinochoroiditis in the mouse--the use of the peroxidase anti-peroxidase method to demonstrate Toxoplasma antigen.

The peroxidase anti-peroxidase immunocytochemical staining method has been used to demonstrate Toxoplasma antigen within paraffin-embedded sections of the eyes of mice congenitally infected with Toxoplasma. Intact Toxoplasma tissue cysts were demonstrated within the retina but in no other ocular structure. No endozoites and no extra-cystic antigens were detected by this technique within any of the eyes examined. The possible implications of these findings in relation to the pathogenesis of toxoplasmic retinochoroiditis are discussed.

Animals↗
PubMed1985

Meningo-encephalitis accompanying retinochoroiditis in a murine model of congenital toxoplasmosis.

A histopathological study of the brains of adult mice infected in utero with Toxoplasma gondii and presenting manifestations of ocular toxoplasmosis is reported. All brains contained Toxoplasma tissue cysts. A sub-acute/chronic meningo-encephalitis was the main feature of the inflammatory response in the brain. Microscopical features suggest that autoimmune processes may play a part in the disease. We suggest that our mouse model will provide a simple and inexpensive tool for the investigation of histopathological processes in the CNS resulting from congenital Toxoplasma infection.

Animals↗
PubMed1985

Distribution of G + C-rich regions in varicella-zoster virus DNA.

The distribution of G + C-rich sequences in the genome of varicella-zoster virus (VZV) was investigated by partial denaturation, equilibrium sedimentation and Southern blot analyses. Portions of the IRS and TRS repeat sequences bounding the US region of the DNA were found to have a G + C content 10 to 20% greater than the overall 47% G + C content of the VZV genome. A stretch of DNA (approx. 1500 base pairs) at the UL-IRS junction and repeated at the terminus of the TRS sequences was found to be about 64% G + C, based on sedimentation equilibrium measurements. We also report the cloning of a novel fragment containing sequences from both the UL and TRS termini of the VZV genome. Our ability to clone this fragment suggests that unusual forms of VZV DNA including closed circular molecules and molecules with an inverted UL region can be packaged into nucleocapsids.

Base Composition↗
PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗
PubMed1985

DNA-binding proteins present in varicella-zoster virus-infected cells.

DNA-binding proteins present in varicella-zoster virus-infected cells were identified by DNA-cellulose chromatography of radioactively labeled cell extracts. Seven virus-specific proteins, ranging in molecular weight from approximately 175,000 to 21,000, showed affinity for single- or double-stranded DNA or both. These proteins include the varicella-zoster virus major capsid protein, a phosphorylated tegument protein, and a 125,000-molecular-weight species which may be analogous to the major DNA-binding protein of herpes simplex virus. We also identified a number of DNA-binding phosphoproteins by these procedures. Finally, protein blot studies were carried out to determine whether these proteins bind preferentially to virus rather than to host cell DNA.

Binding Sites↗
PubMed1985

Inversion and circularization of the varicella-zoster virus genome.

The genome of varicella-zoster virus (VZV) is a linear, double-stranded molecule of DNA composed of a long (L) region covalently linked to a short (S) region. The S region is capable of inverting relative to a fixed orientation of the L region, giving rise to two equimolar populations. We have investigated other forms of the VZV genome which are present in infected cells and packaged into nucleocapsids. That a small proportion of nucleocapsid DNA molecules also possess inverted L regions has been verified by the identification of submolar restriction fragments corresponding to novel joints and novel ends generated by such an inversion. The presence of circular molecules has been investigated by agarose gel electrophoresis. Bands corresponding to circular forms were present in small amounts in both VZV-infected cell DNA and nucleocapsid DNA. Southern blot analysis verified that these bands contained VZV sequences. We therefore conclude that the VZV genome may occasionally contain an inverted L region or exist in a circular configuration.

Base Sequence↗