Search PubMed⌕ Search

Biomedical subjects

J H Bates

Publications and source records attributed to J H Bates.

At least 127 records · Page 7Linked to original sources
PubMed1991

Detection of Mycobacterium tuberculosis in sputum samples using a polymerase chain reaction.

A polymerase chain reaction (PCR) assay for the rapid detection of Mycobacterium tuberculosis in sputum samples is described. The target DNA is a 123-base pair (bp) segment of IS6110, which is repeated in the M. tuberculosis chromosome and is specific for the M. tuberculosis complex. Methodology used to lyse the mycobacteria, extract the DNA, and amplify the 123-bp target DNA is presented. The amplified PCR product is detected by examination of ethidium-bromide-stained acrylamide gels. An internal control using the same primers as the target DNA has been constructed to assess the efficacy of each individual reaction. Of 162 sputum samples tested, 82 were smear-positive for acid-fast bacilli. Of the 94 specimens from patients in whom pulmonary tuberculosis was diagnosed, 51 were culture-positive, smear-positive, or both. Fifty of these were PCR positive. Of the 42 specimens from patients with nontuberculous mycobacterial pulmonary disease, 41 were PCR negative. All 26 specimens from patients without mycobacterial infection were PCR negative. This assay provides a sensitive and specific means for the laboratory diagnosis of tuberculosis within 48 h that is relatively simple to perform.

DNA, Bacterial↗
PubMed1991

Lung mechanics--the inverse problem.

The mechanical properties of the lung are important determinants of its efficacy as a gas exchanging organ. These properties are reflected to a precise degree in the relationships between pressure and flow measured at the mouth. Together with oesophageal pressure, which reflects the pressure in the pleural space, these quantities allow one to usefully indulge in inverse modelling of the lung - that is, identify mathematical models of lung mechanics that give insight into its structure and may be diagnostic of certain diseases. The complexity of such models, however, is limited by the number of distinct components that can be unambiguously resolved from the measured signals. The development of more detailed models requires the availability of experimental methods for obtaining additional input-output information from the lungs. One such method is the so-called alveolar capsule technique which allows alveolar pressures at several sites on the lung surface to be measured directly. This technique has been used in animals to show that the mechanical behaviour of normal lungs in the breathing frequency range is well described by a homogeneously ventilated compartment surrounded by viscoelastic tissue. During bronchoconstriction, however, the lungs can become markedly inhomogeneous resulting from differences in regional resistive and elastic properties. Model ambiguity problems again appear as it becomes impossible to distinguish changes in local resistance from changes in elastance using only the information obtained from alveolar capsules. To push the inverse modelling of the lung one step further, we have recently developed a new technique for quantifying changes in local resistance and elastance by applying broad-band oscillations in flow to the lung through a small hole in the pleura, thereby obtaining an alveolar input impedance.

Animals↗
PubMed1991

Two-compartment modelling of respiratory system mechanics at low frequencies: gas redistribution or tissue rheology?

The mechanical properties of the respiratory system are generally inferred from measurements of pressure and flow at the airway opening. Traditionally, these measurements have been related through a single-compartment model of the respiratory system. Recently, however, there has been considerable interest in modelling low-frequency respiratory mechanics in terms of two compartments, since this gives a much improved description of experimental data. In this paper we consider two classes of two-compartment models that are compatible with pressure-flow relationships of air measured at the airway opening. One type of model accounts for regional ventilation inhomogeneity in the lung in terms of two alveolar compartments. The other type of model considers pulmonary ventilation to be homogeneous, while the tissues of the respiratory system are modelled as being viscoelastic. In normal dogs, the appropriate two-compartment model has been shown to be the viscoelastic model. In the case of abnormal physiology, however, one must invoke a model having both viscoelastic tissues and ventilation inhomogeneities. Additional experimental data are required in order to identify such a model, and to quantify these two phenomena.

Airway Resistance↗
PubMed1991

Host determinants of susceptibility to Mycobacterium tuberculosis.

Susceptibility to tuberculosis is determined by a number of host factors and may vary according to characteristics of the infecting strain. Native resistance is probably mediated via the macrophage and is under genetic control. Other factors that contribute to native resistance are nutrition, associated disease states, age, and sex. Acquired resistance is mediated via macrophages and controlled by T-helper cells. The ability of an activated macrophage to phagocytize and kill virulent tubercle bacilli is influenced by the function and number of T-helper cells. The macrophages are affected by concurrent disease states and immunosuppressive drugs. Macrophages provide local immunity, once activated, and T-helper lymphocytes provide the long-term systemic immunity.

Animals↗
PubMed1991

Atypical pneumonia.

The atypical pneumonia syndrome usually implies a benign illness where systemic complaints predominate over respiratory symptoms. Cough is prominent; chest radiographic findings are varied. Many organisms are associated with this syndrome. Mycoplasma pneumoniae, Chlamydia psittaci, Chlamydia pneumoniae, Coxiella burnetii, and Francisella tularensis are reviewed in this article.

Chlamydia Infections↗
PubMed1990

Effect of the thermodynamics of an infant plethysmograph on the measurement of thoracic gas volume.

Adult plethysmographs have frequency responses that are essentially flat over the range of frequencies encountered in the measurement of thoracic gas volume (TGV). An infant plethysmograph is necessarily much smaller than an adult model. This means that there is a smaller mean distance over which heat diffusion must occur between the air in the plethysmograph and its walls. This in turn leads to a much reduced thermal time constant. We examined the effects of thermal time constant of a 60 L infant plethysmograph on measurements of TGV in infants. The thermal time constant was measured by rapidly injecting 20 mL of air into the plethysmograph, and found to be 0.16 +/- 0.09s when the box was empty. We calculated from this time constant that measurements of TGV should be quite dependent on the frequency at which the associated panting maneuvers are performed. TGV was measured in 5 infants less than 6 months old in the recovery phase following acute viral bronchiolitis. When we performed a digital correction of the measurements, to compensate for the thermal time constant of the plethysmograph, the TGV values decreased by a mean of 12%. Agitating the air in the plethysmograph with a fan decreased the thermal time constant of the box and reduced measured TGV by a mean of 8.4%. These results indicate that thermodynamics of infant plethysmographs can be an important source of error in TGV measurements.

Algorithms↗
PubMed1990

Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis.

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.

Base Sequence↗
PubMed1990

Interpretation of interrupter resistance after histamine-induced constriction in the dog.

The interrupter method for measuring respiratory system resistance involves interrupting flow at the airway opening and measuring the resultant changes in pressure. We have recently shown (J. Appl. Physiol. 65: 408-414, 1988) that in open-chest mongrel dogs, under control conditions, the initial rapid pressure change (delta Pinit) reflects conducting airway resistance and the subsequent gradual pressure change (delta Pdif) reflects stress recovery of the tissues. We questioned whether the same interpretation would apply after induced constriction. Accordingly, we performed interruption experiments on anesthetized, paralyzed, tracheostomized, open-chest mongrel dogs during passive expiration, measuring pressure at the trachea and in three different alveolar regions with alveolar capsules. We recorded measurements before and after the administration of increasing concentrations of histamine aerosol (0.1-30.0 mg/ml). We found a significant increase in the heterogeneity of alveolar pressures during the relaxed expiration with increasing concentrations of histamine. Despite the introduction of significant mechanical heterogeneities, delta Pinit still reflected the pressure drop as the result of the resistance of the conducting airways. delta Pdif, however, reflected a combination of the stress recovery of the tissues and pendelluft.

Airway Resistance↗
PubMed1990

Quasi-static pressure-volume hysteresis in the canine respiratory system in vivo.

We investigated the quasi-static pressure-volume (P-V) hysteresis of the normal canine lung in vivo by performing 15-s flow interruptions at various points throughout the breathing cycle in mechanically ventilated anesthetized paralyzed dogs. By measuring the transpulmonary pressure (Ptp) at 5 s after each interruption, we built up a quasi-static P-V loop of the lungs. We found, however, that the area of the loop was significantly smaller (by a factor of 4-6) than has been reported by others for the isolated canine lung. We also found the hysteresis loop area of the chest wall to be of similar magnitude. If we measured Ptp 10-15 s after interruption, we found it always decreased at a rate expected to result from continuing gas exchange in the lungs. We conclude that 1) the areas of the quasi-static P-V loop in vivo for the total respiratory system, as well as the lungs and chest wall separately, are significantly smaller than has been reported previously for isolated lungs and 2) continuing gas exchange in the lungs places a lower limit on the frequencies (equivalent to flow interruptions of greater than 5- to 7-s duration) at which the P-flow-V behavior of the lungs in vivo can be considered in purely mechanical terms.

Animals↗
PubMed1990

A theoretical study of the effect of airway smooth muscle orientation on bronchoconstriction.

If airway smooth muscle shortened in vivo to the extent that it does in vitro, then maximal bronchoconstriction would result in complete closure of virtually all airways. The fact that this does not happen indicates the existence of inhibitory mechanisms preventing maximal muscle shortening. There are many factors potentially limiting shortening in vivo. In this study we investigated one of these factors, the orientation of the smooth muscle around the airway wall. The airway was modeled as a cylinder of given wall thickness around which the muscle was wound as a spiral. The longitudinal and circumferential elasticities of the airway were embodied in a 2 x 2 matrix of elastic coefficients. We investigated smooth muscle shortening under three conditions: 1) a longitudinally stiff airway, 2) a circumferentially stiff airway, and 3) a longitudinally and circumferentially compressible airway. In case 1, for a given degree of smooth muscle shortening, airway resistance increased markedly with increasing pitch of the smooth muscle spiral. On the other hand, the muscle tension required to elicit a given change in resistance also increased markedly with pitch. In case 2, the effect with increasing pitch was reversed. In case 3, resistance first increased and then decreased as spiral pitch increased. Similarly, the muscle tension required to elicit a given change in resistance first increased and then decreased with pitch. These results suggest that the orientation of the smooth muscle about the airway may be very important in determining airway responsiveness.

Airway Resistance↗
PubMed1990

Late response of the upper airway of the rat to inhaled antigen.

We studied the magnitude and time course of changes in upper airway resistance (Ruaw) of actively sensitized Brown-Norway rats after aerosol challenge with ovalbumin (OA). Two weeks after sensitization, eight rats were challenged by inhalation of aerosolized OA through the nose. The airway responses of these rats 5-10 h after OA challenge were compared with those of seven animals challenged with saline. Seven of eight test rats had increased Ruaw, and six displayed discrete late responses (LR). Ruaw during expiration was highly alinear so analysis was confined to Ruaw during inspiration (Ruaw,I). The Ruaw,I averaged over 5 h was 1.262 +/- 0.09 (SE) cmH2O.ml-1.s, 2.6 times the value for saline-challenged animals (0.476 +/- 0.143 cmH2O.ml-1.s), and it reached a peak value of 3.454 +/- 0.45 cmH2O.ml-1.s. The time to the peak of the LR was 446 +/- 37.3 min. The duration of the LR in the upper airway was 146 +/- 34.9 min. At the time corresponding to the peak value of Ruaw,I, the lung elastance in the test rats was double the value preceding the peak. Lung elastance was unchanged in the control group. We conclude that inhalation of antigen through the upper airway of the sensitized rat results in a substantial increase in upper airway resistance and a distinct LR. The predominant site of the change in respiratory system resistance is in the upper airway.

Administration, Inhalation↗
PubMed1990

Exponential fitting of pressure-volume curves: confidence limits and sensitivity to noise.

It has recently become common to model the static pressure-volume curve of the lung as a monoexponential function of the form V = A - Be-KP, where V is volume and P is transpulmonary pressure. The parameters A, B, and particularly K have been employed as descriptors of the intrinsic mechanical properties of the lung. The purpose of the present study was to investigate the sensitivities of A, B, and K to noise in measurements of P and V and to incompleteness of data. Using Monte-Carlo simulation, we found that the presence of typical levels of noise in P led to biased estimates of K and that the 95% confidence intervals about A and K were large compared with the parameter values themselves. These effects were increased as points were systematically removed from either end of the data set. These findings show that values of K estimated from PV data are difficult to interpret without accompanying confidence intervals.

Air Pressure↗
PubMed1990

High-frequency characteristics of respiratory mechanics determined by flow interruption.

When flow at the airway opening is suddenly interrupted, the pressure measured just behind the point of interruption generally exhibits certain characteristic features, including some rapid and highly damped oscillations immediately after the interruption. It has previously been assumed that these oscillations reflect ringing of central airways gas. In the present study we investigated this hypothesis by performing flow interruptions during relaxed expiration in normal, tracheostomized, anesthetized, paralyzed dogs while the lungs were filled with four different gas mixtures having widely varying physical properties. We found that the power spectrum of the oscillations exhibited two peaks. The larger peak was centered about a frequency that varied approximately linearly with the inverse of the square root of the gas density. The other peak was smaller and was located at approximately 70 Hz with all gas mixtures. The area under the power spectrum of the ringing varied approximately linearly with the density of the gas mixture. These results indicate that the larger peak in the power spectrum reflects the quarter-wave resonance of the gas in the airways, whereas the smaller peak reflects a tissue resonance.

Animals↗
PubMed1989

Evaluation of the flow-volume loop as an intra-operative monitor of respiratory mechanics in infants.

Airway pressure is currently the primary indicator of respiratory mechanics used by the anesthetist in the operating room. This quantity can signal that the mechanical properties of the respiratory system have changed. However, there is a need for more sophisticated monitors of mechanics, capable of indicating the nature of the change. We have investigated the use of the tidal flow-volume loop in differentiating between an obstruction of the endotracheal tube and changes in the distribution of regional ventilation, using a computer model. Endotracheal obstruction caused the descending limb of flow-volume loop to become convex to the volume axis, whereas ventilation inhomogeneity caused the curve to become concave to the volume axis. In contrast, examination of peak airway pressure did not allow differentiation between the two conditions. We conclude that, while the peak airway pressure is useful in signaling a change in a patient's condition, the combination of airway pressure and the flow-volume loop serves as a more comprehensive monitor of respiratory mechanics.

Computer Simulation↗