Search PubMedSearch

Biomedical subjects

J Gottschalk

Publications and source records attributed to J Gottschalk.

At least 19 recordsLinked to original sources

Discrimination of respiratory syncytial virus subgroups A and B by reverse transcription-PCR.

Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.

Antibodies, Monoclonal

Intratumorous heterogeneity of chromosome 10 and 17 in meningiomas using non-radioactive in situ hybridization.

Contrary to classical cytogenetics non-radioactive chromosomal in situ hybridization (CISH) may be performed within 24 hours while the morphological structure of paraffin-embedded tumor material is preserved. Slides of 34 formalin fixed and paraffin-embedded meningiomas were hybridized with a biotinylate alpha-satellite DNA-probe for chromosome 10 and 17. According to the distribution of hybridization signals per nucleus we found five meningiomas with signs of trisomy 17 whereby all of them exhibited intratumorous heterogeneity. Trisomy 10 was found in five tumors. Monosomy 17 was assumed in two cases and monosomy 10 in one meningioma. As a control six meningiomas were karyotyped by G-banding. Formalin fixed and paraffin-embedded tissue of the same tumors was hybridized against chromosome X and Y. In five of six cases the result of conventional karyotyping could be confirmed by in situ hybridization. CISH of paraffin-embedded tissue is new tool for the analysis of intratumorous cytogenetical heterogeneity with potential prognostic significance.

Adult

Development of traumatic brain edema in old versus young rats.

Age is an important factor of mortality and morbidity following traumatic brain injury. The causes for the adverse effect of old age remain obscure. The aim of this study was to clarify whether age affects the development of posttraumatic brain edema. In Wistar rats, a cortical freezing lesion was applied to the parietal region in ketamine-xylazine anesthesia. 18 young rats (4-6 months) were compared to 15 old animals (36-40 months). In the early peritraumatic and late posttraumatic period blood pressure was monitored. 24 hours after trauma, the brains were removed and hemispheric swelling, water- und electrolyte-contents were measured. In addition, the brains of 3 animals of each group were histologically evaluated. In the old age group, 3 animals died during the 24 hours observation period (mortality 20%), whereas all young rats survived (p < 0.01). The cortical freezing lesion resulted in a hemispheric swelling of 6.9 +/- 0.5% in young, and 10.4 +/- 0.8% in old animals (p < 0.001). Accordingly, the increase of cerebral water content due to the lesion was significantly more pronounced in the group of old rats, i.e. 2.05% in old versus 1.50% in young animals (p < 0.01). The increase of swelling and edema in the old age group could not be attributed to arterial hypertension. On the contrary, mean arterial blood pressure was significantly lower in old animals. Histological examinations did not reveal significant differences between the two groups. Edema generation following a standardized cryogenic lesion is markedly enhanced in old versus young rats. This might be one factor among others for higher mortality and morbidity following traumatic brain injury in old versus young individuals.

Age Factors

Clinical, radiological and histological findings in desmoplastic infantile ganglioglioma.

The clinical course and radiological and histological findings in a 30-month-old boy suffering from desmoplastic infantile ganglioglioma are reported. The child's development was normal until a series of complex partial seizures occurred at the age of 7 months. Cranial computed tomography and magnetic resonance imaging revealed a cystic mass with intensive ring-shaped contrast enhancement in the right temporal fossa without shift of intracranial structures. Histologically, the firm, grayish tumor showed an enormous amount of connective tissue, cystic areas, and some mitoses. Glial and neuronal cell lines were identified by immunocytochemical methods. Eighteen months after surgery the boy had developed well without any neurological dysfunction; no radiation or chemotherapy was given. For the first time a synopsis of radiological findings in this rare brain tumor is correlated with the results of multiple histological and immunocytochemical studies. Despite some malignant characteristics, the prognosis of this dysontogenetic brain tumor is good.

Age of Onset

Intramedullary epidermoid cyst. A case report.

The authors add to the literature a case report of a 32-year-old man with an intramedullary epidermoid cyst at the level of D 3/4, that was successfully operated on. There are several previous reports in the literature, but only five of these include MRI studies.

Adult

[Concentrations of 17 beta-estradiol, testosterone and progesterone in ovarian cyst fluid and intact ovarian follicles of swine].

The concentrations of 17 beta-oestradiol, testosterone and progesterone were determined in the fluid of ovarian cysts of 80 sows. The cysts were grouped into the following categories: follicle theca cysts, follicle lutein cysts, lutein cysts, blood cysts and mixed forms. By comparison the concentrations of 17 beta-oestradiol, testosterone and progesterone were determined in the fluid of normal follicles of 100 pigs during the dioestrus, prooestrus and oestrus. The concentrations of progesterone were higher in the fluid of cysts of all groups investigated than in the fluid of normal follicles. The concentrations of 17 beta-oestradiol and testosterone were lower in the cyst fluid than in the follicular fluid. There were not serious differences in the hormone profiles of the cyst fluid between the cysts of the different categories.

Animals

The use of immunomorphology to differentiate choroid plexus tumors from metastatic carcinomas.

BACKGROUND: The histologic and immunohistologic differential diagnosis of choroid plexus papillomas/plexus carcinomas (PP/PC) versus metastatic carcinoma in the brain is problematic. METHODS: Thirty-four choroid PP/PC from 28 patients, 5 normal choroid plexus, and 45 cerebral metastatic carcinomas were immunohistochemically examined with the monoclonal anti-epithelial noncytokeratin antibodies HEA 125 and Ber EP4 using the alkaline phosphatase anti-alkaline phosphatase (APAAP) method. RESULTS: Normal choroid plexus epithelium was consistently negative. Sections from PP/PC of 3 of 28 patients demonstrated immunoreactivity for these antibodies. In contrast, 43 of 45 cerebral metastatic carcinomas displayed positive immunostaining for HEA 125, and 44 of these 45 carcinomas were positive for Ber EP4. Thus, sensitivity was higher for these antibodies than for the monoclonal anticytokeratin antibody KL1 (41/45). All three HEA 125/Ber EP4-positive PP/PC contained periodic acid-Schiff (PAS)-positive, tall columnar tumor cells. The intensively HEA 125, Ber EP4, and PAS-positive PP/PC were interpreted as possible transitional forms of the mucus-secreting and acinar PP/PC: CONCLUSIONS: Despite this restriction, the authors proposed the application of HEA 125 and Ber EP4 as a reliable tool in the differential diagnosis of PP/PC versus metastatic carcinoma, especially in combination with glial fibrillary acid protein and transthyretin. Currently, all HEA 125/Ber EP4-positive PP/PC in patients older than 20 years proved to be metastatic carcinomas during their clinical course.

Adolescent

Extracerebral toxoplasmosis in AIDS. Histological and immunohistological findings based on 80 autopsy cases.

Despite the great amount of literature concerning toxoplasmic encephalitis in AIDS patients, little is known about extracerebral toxoplasmosis. Therefore we conducted a study of 80 autopsy cases to estimate the frequency of extracerebral toxoplasmosis. A control group of 50 cases was completely negative for all markers applied. In 35 of the 80 AIDS-cases (43.7%), organisms could be detected. In 13 cases (16.2%) there was an extracerebral toxoplasmosis; 4 cases (5%) showed only extracerebral involvement and in 9 cases (11.2%), extracerebral toxoplasmosis occurred in combination with cerebral manifestations. In 22 cases (27.5%), only cerebral toxoplasmosis was found. The following organs were involved: cardiac muscle (15%), lungs (6.2%), liver (5%), pancreas (5%), gastrointestinal tract (6.2%), adrenal glands (5%), lymph nodes (5%) and testis (3.7%). In individual cases further organs, not mentioned above, were involved. Pseudocysts could be demonstrated within necroses and inflammatory foci by conventional staining, whereas trophozoites became apparent only immunohistologically.

Acquired Immunodeficiency Syndrome

Amelanotic malignant melanoma presenting as malignant schwannoma.

A 78-year-old woman presented with a 14-month history of a nodule on the sole of her left foot. It had been increasing in size, and had become ulcerated. Histological, immunochemical and ultrastructural studies of the primary tumour revealed melanocytic and Schwannian characteristics, and posed diagnostic difficulties. The final diagnosis of a malignant melanoma with Schwannian differentiation was established on the basis of the clinical course, with the development of metastases in the subcutis, lymph nodes, liver and brain, as well as a shift in differentiation of the metastases towards cells containing giant melanosomes, typical of melanoma.

Aged

Factor XIIIa immunoreactivity in primary and secondary tumours of the meninges.

Occasionally variants of meningeal hemangiopericytomas (HPC) may be confused with primary and secondary tumours of the meninges by virtue of their features and patterns of growth. Until now, a specific immunohistochemical marker for HPC could not be identified. HPC are reported to express factor XIIIa (F XIIIa) in the cytoplasm of the tumour cells. In an effort to assess the diagnostic value of F XIIIa for meningeal HPC, we investigated 38 primary meningeal tumours (6 HPC, 28 meningiomas of various subtypes, 4 meningeal sarcomas) and 23 secondary meningeal tumors (8 metastatic carcinomas, 6 gliosarcomas, 9 anaplastic gliomas) with anti-F XIIIa antibody. All HPC revealed 5%-20% of F-XIIIa-positive neoplastic cells. Malignant fibrous histiocytomas and gliosarcomas with MFH-like structures also exhibited multiple F-XIIIa-positive cells. Most of the F-XIIIa-positive cells in meningiomas were identified as macrophages. Furthermore, there was a population of small dark cells of uncertain histogenesis. Cells with positive immunoreactivity for F-XIIIa in metastatic carcinomas and gliomas apparently were of macrophage lineage. Though, in some cases, it would have been difficult to distinguish reactive from neoplastic cells without simultaneous immunohistochemical investigation with antibodies for macrophages, cytokeratin, EMA and GFAP. Because of these uncertainties, wo believe that the potential of F XIIIa-antibody in obtaining precise differential diagnostic information is limited.

Carcinoma

Prevention of Pneumocystis carinii pneumonia and toxoplasmic encephalitis in human immunodeficiency virus infected patients: a clinical approach comparing aerosolized pentamidine and pyrimethamine/sulfadoxine.

The incidence of Pneumocystis carinii pneumonia (PCP) and toxoplasmic encephalitis (TE) was analyzed in 83 human immunodeficiency virus (HIV)-infected patients who inhaled aerosolized pentamidine (AP) either for primary prophylaxis (group Ia) or secondary prophylaxis (group IIa) of PCP. These cohorts were compared with two historical groups of patients who took Fansidar (pyrimethamine/sulfadoxine) for primary prophylaxis (group Ib) or secondary prophylaxis (group IIb) of PCP. The follow-up was 3-41 months (median 8 months). PCP did not occur in group Ia but was seen in 1 patient of group Ib (5%). TE was observed in 3 patients of group Ia (7.3%) and in 1 patient of group Ib (5%). PCP relapses were seen in 5 patients of group IIa (11.9%) and in 3 patients of group IIb (6.9%), whereas TE occurred in 13 patients of group IIa (30.9%) and in 1 patient of group IIb (2.3%). 20.3% of patients with CD4+ counts less than or equal to 100/microliters and only 7.7% of those with CD4+ counts greater than 100/microliters developed toxoplasmosis. In conclusion, Fansidar rather than AP prophylaxis should be recommended for patients with a history of PCP or toxoplasmosis and for all HIV-infected patients with CD4+ counts less than or equal to 100/microliters. In patients with CD4+ lymphocyte counts between 100 and 200/microliters, AP prophylaxis appears appropriate.

Adult

Stereotactic brain biopsy in AIDS.

In the hope of finding a treatable condition, the need for rapid diagnosis in HIV-seropositive patients with brain lesions is apparent. In order to evaluate the efficacy of stereotactic brain biopsy in AIDS patients, we retrospectively studied 25 HIV-infected patients undergoing stereotactic biopsy. Brain lesions were identified with gadolinium-enhanced MRI and/or contrast CT. Brain biopsy was performed using the system of Riechert. From 8 up to 15 small tissue samples from one or two targets were obtained in every patient. The biopsy material was examined cytologically, histologically (including electron microscopy), immunohistochemically and, in part, by animal test and polymerase chain reaction (PCR). A definite diagnosis was achieved in 92%. Diagnosis included primary central nervous system lymphoma (PCNSL) (10), toxoplasmosis (10), progressive multifocal leukoencephalopathy (2) and one case of co-existing toxoplasmosis and cytomegalovirus infection. Two biopsies were non-diagnostic. All PCNSLs showed polymorphic B-cell populations of high malignancy; accurate classification according to the Kiel classification was not possible. In 3 lymphomas Epstein-Barr nuclear antigen (EBNA) 2-mRNA could be detected by PCR and confirmed immunohistochemically by EBNA 2 expression. In 6 cases autopsy confirmed the biopsy diagnosis. Conventional histology was not sufficiently decisive for toxoplasmosis and progressive multifocal leukoencephalopathy, so that immunohistochemistry and animal tests became very important for a final diagnosis. With the help of different morphological and molecular biological techniques stereotactic brain biopsy appears to be an effective method in the diagnosis of HIV-associated brain lesions. In view of the marked radio- and chemosensitivity of PCNSLs it is mandatory to establish an early and accurate histological diagnosis for adequate treatment.

Acquired Immunodeficiency Syndrome

Melanoma-associated antigens in tumours of the nervous system: an immunohistochemical study with the monoclonal antibody HMB-45.

The aim of this study was to determine the specificity and sensitivity of the commercially available, monoclonal anti-melanoma antibody HMB-45 in brain tumours and peripheral nerve sheath tumours. Hence, a series of 155 different non-melanotic tumours of the central and peripheral nervous system were examined immunohistochemically. The brain lesions consisted of primary tumours and metastases from various carcinomas. Twenty melanotic tumours (cerebral metastases of malignant melanomas, meningeal melanomatosis, meningeal melanocytomas) and dermal blue cell naevi served as controls. All melanotic tumours stained positive. Furthermore, a positive immunohistochemical reaction was observed in the following non-melanotic tumours: gliosarcomas, primitive neuroectodermal tumours, ependymoma, malignant schwannomas and different intracranial hamartomas. Two plasmacytomas and 4 metastatic carcinomas also revealed positive staining for HMB-45. Our results confirm the necessity for cautious interpretation of HMB-45 immunoreactivity as a tool in the immunohistochemical characterization of nervous system tumours.

Antibodies, Monoclonal

Epithelial and melanoma antigens in gliosarcoma. An immunohistochemical study.

Gliosarcomas are mixed tumors with malignant glial and mesenchymal elements. The number of GFAP-positive tumor cells decreases with the increase of sarcomatous components, until whole areas may be GFAP negative. These distinct differentiations may, however, lead to false interpretations in small tissue samples. In this connection, it is of interest that, according to other reports, glial tumors may be positive for different anti-keratin antibodies and this prompted us to undertake a systematic investigation of the immunoreactivity of gliosarcomas using a panel of well-characterized monoclonal antibodies against cytokeratins (KL1, AE 1/3, Lu-5, CK-19, CK MNF 116 and Ma-903). These cases were further studied with the anti-epithelial non-cytokeratin antibodies EMA, HEA 125, Ber-EP4, CEA as well as the melanoma-antibody HMB-45, Leu-M1, GFAP and vimentin. As screening study we examined 20 cerebral metastatic carcinomas, 21 malignant gliomas (including 6 gliosarcomas) and 3 metastatic melanomas with the monoclonal antibodies KL1 and HMB-45. All cerebral metastatic carcinomas and 4/6 gliosarcomas were positive for KL1, whereas all melanomas, 2 metastatic carcinomas and 3 gliosarcomas showed an immunostaining with HMB-45. All gliosarcomas were positive with at least one of the tested anti-cytokeratin antibodies. The gliosarcomas did not show an immunoreaction in any of the cases when CEA, HEA 125, Ber-EP4, EMA or Leu M1 were applied. In our opinion, the monoclonal antibodies HEA 125 and Ber-EP4 could obviously be helpful in differentiating gliosarcomas from metastatic carcinomas.

Antibodies, Monoclonal

Proliferating cell nuclear antigen (PCNA) in atypical and malignant meningiomas.

Because it is not easy to determine the tumor status of meningiomas by current diagnostic procedures, we investigated these tumors immunohistochemically using the monoclonal antibody PC 10. This antibody recognizes a fixation- and processing-resistant epitope of the proliferating cell nuclear antigen (PCNA), which is a 36-KD nuclear antigen associated with the cell cycle. We studied paraffin-embedded and formalin-fixed tissue specimens of a group of 21 atypical/malignant meningiomas together with 18 benign meningiomas. PCNA staining results were compared with the mean number of silver-stained nucleolar organizer region-associated proteins (AgNORs), tumor grading, and mitotic indices of these tumors. The percentage of PCNA-positive cells was found to range between 0.1% and 40%, irrespective of the tumor grade. When all tumors were collectively considered, no positive correlation was found between PCNA scores and histologic grading and only a weak one between PCNA score and mitotic index. A higher correlation was seen between AgNOR counts and tumor grading. Our results suggest that PCNA labeling and histologic grading seem to be independent parameters. The correlations found between AgNOR counts and tumor grading should be substantiated in further series.

Antigens, Nuclear

A simplified agarose gel electrophoresis for rotavirus detection.

The use of agarose gel electrophoresis for rotavirus detection is a suitable routine method if simplifying modifications are introduced. Incorporation of ethidium bromide into the agarose gel permits its use for several times in the course of one week without further staining of the RNA segments. The electrophoresis chamber with a UV-light-transparent bottom is put directly onto the transilluminator and the RNA bands of the rotavirus can be visualized without manipulating the gel tray. During the winter of 1990/91, we found a good sensitivity (98%) of this method in comparison to a latex agglutination test (Slidex Rota-Kit 2, bio Mérieux).

Child