Search PubMed⌕ Search

Biomedical subjects

J Gao

Publications and source records attributed to J Gao.

At least 397 records · Page 22Linked to original sources
PubMed1995

Androgen control of secretory component mRNA levels in the rat lacrimal gland.

The purpose of this investigation was to determine whether the known gender-related differences in, and the endocrine control of, the production of secretory component (SC) by the rat lacrimal gland are associated with alterations in SC mRNA content. Levels of SC mRNA were measured in lacrimal tissues of intact, sham-operated, castrated, hypophysectomized, and testosterone-treated male and female adult rats by Northern blot procedures, which utilized a specific, [alpha-32P]-labelled rat SC cDNA probe. For control purposes, SC mRNA amounts were standardized to the beta-actin content in experimental blots. The location of SC mRNA in lacrimal glands was evaluated by in situ hybridization techniques, which involved exposure of tissue sections to sense or anti-sense [35S]-labelled SC RNA probes. Our results demonstrate that: (1) lacrimal glands of male rats contain a significantly greater amount of SC mRNA than those of female rats, and that this difference co-exists with distinct, gender-associated variations in the distribution of SC mRNA in lacrimal tissue; (2) orchiectomy or hypophysectomy, but not ovariectomy or sham surgery, leads to a marked decline in the lacrimal SC mRNA content; and (3) testosterone, but not placebo, administration to castrated male and female rats induces a significant increase in the SC mRNA levels in lacrimal tissue. Overall, these findings show that gender, androgens and the hypothalamic-pituitary axis exert a considerable influence on the SC mRNA content in the rat lacrimal gland.

Animals↗
PubMed1995

Two functionally different Na/K pumps in cardiac ventricular myocytes.

The whole-cell patch-clamp technique was used to voltage clamp acutely isolated myocytes at -60 mV and study effects of ionic environment on Na/K pump activity. In quiescent guinea pig myocytes, normal intracellular Na+ is approximately 6 mM, which gives a total pump current of 0.25 +/- 0.09 pA/pF, and an inward background sodium current of 0.75 +/- 0.26 pA/pF. The average capacitance of a cell is 189 +/- 61 pF. Our main conclusion is the total Na/K pump current comprises currents from two different types of pumps, whose functional responses to the extracellular environment are different. Pump current was reversibly blocked with two affinities by extracellular dihydro-ouabain (DHO). We determined dissociation constants of 72 microM for low affinity (type-1) pumps and 0.75 microM for high affinity (type-h) pumps. These dissociation constants did not detectably change with two intracellular Na+ concentrations, one saturating and one near half-saturating, and with two extracellular K+ concentrations of 4.6 and 1.0 mM. Ion effects on type-h pumps were therefore measured using 5 microM DHO and on total pump current using 1 mM DHO. Extracellular K+ half-maximally activated the type-h pumps at 0.4 mM and the type-1 at 3.7 mM. Extracellular H+ blocked the type-1 pumps with half-maximal blockade at a pH of 7.71 whereas the type-h pumps were insensitive to extracellular pH. Both types of pumps responded similarly to changes in intracellular-Na+, with 9.6 mM causing half-maximal activation. Neither changes in intracellular pH between 6.0 and 7.2, nor concentrations of intracellular K+ of 140 mM or below, had any effect on either type of pump. The lack of any effect of intracellular K+ suggests the dissociation constants are in the molar range so this step in the pump cycle is not rate limiting under normal physiological conditions. Changes in intracellular-Na+ did not affect the half-maximal activation by extracellular K+, and vice versa. We found DHO-blockade of Na/K pump current in canine ventricular myocytes also occurred with two affinities, which are very similar to those from guinea pig myocytes or rat ventricular myocytes. In contrast, isolated canine Purkinje myocytes have predominantly the type-h pumps, insofar as DHO-blockade and extracellular K+ activation are much closer to our type-h results than type-1. These observations suggest for mammalian ventricular myocytes: (a) the presence of two types of Na/K pumps may be a general property. (b) Normal physiological variations in extracellular pH and K+ are important determinants of Na/K pump current. (c) Normal physiological variations in the intracellular environment affect Na/K pump current primarily via the Na+ concentration. Lastly, Na/K pump current appears to be specifically tailored for a tissue by expression of a mix of functionally different types of pumps.

Animals↗
PubMed1995

A monoclonal antibody to the NH2-terminal region of human interferon-gamma inhibits its antiproliferative activity without affecting its internalization.

MAb IGMB-15, an anti-hIFN-gamma MAb, neutralizes the antiproliferative activity of hIFN-gamma without affecting that of hIFN-alpha or hIFN-beta. The neutralizing capacity of MAb IGMB-15 is wide: it has been assessed on cell lines whose origin and sensitivity to hIFN-gamma differ. The binding of hIFN-gamma to its receptor and its subsequent internalization into the target cell were not influenced by the antibody. MAb IGMB-15 has been found to interact with hIFN-gamma in solution but not when the lymphokine was associated with its cell surface receptor, showing that the growth of certain cell lines can be inhibited at the cell membrane level. This finding is consistent with the existence of an accessory factor responsible for the antiproliferative activity of hIFN-gamma.

Antibodies, Monoclonal↗
PubMed1995

Kinetics of 2-deoxyglucose transport in skeletal muscle: effects of insulin and contractions.

There is some controversy regarding whether insulin or contractile activity alters the affinity of skeletal muscle glucose transporters for glucose and its analogues. The effects of insulin and contractions on the kinetics of glucose transport were therefore reexamined in isolated rat skeletal muscles. Concentration-dependent rates of 2-deoxyglucose (2-DG) transport were measured in the absence or presence of insulin (2 mU/ml) in the epitrochlearis and split soleus muscles. The apparent half-maximal saturating substrate concentration (Km) for basal 2-DG transport (approximately 12 mM) was similar for the split soleus and epitrochlearis, and the apparent Km was not changed by insulin in either muscle type. The presence of 2 mU/ml insulin increased the maximal transport velocity (Vmax) approximately fourfold in the epitrochlearis and approximately eightfold in the split soleus. In the epitrochlearis, in vitro muscle contractions also resulted in an approximately fourfold increases in Vmax with no change in apparent Km. The combined effects of insulin and contractions on Vmax were completely additive, but the apparent Km was not different from insulin alone. The apparent Km values for basal and insulin-stimulated glucose transport were further characterized in the epitrochlearis isolated from transgenic mice overexpressing the GLUT-1 isoform in the sarcolemma and their nontransgenic littermates. The apparent Km for basal 2-DG transport in the transgenic muscle (9 mM) was not significantly different from the apparent Km for insulin-stimulated transport in the control muscle (10 mM). The present study provides evidence that insulin and contractions, either alone or in combination, increase glucose transport activity in skeletal muscle by increasing Vmax, with no significant change in Km. Our results also suggest that, in intact skeletal muscle, the Km for basal glucose transport (a process mediated primarily by GLUT-1) is similar to the Km values for stimulated transport, mediated predominantly by GLUT-4.

Animals↗
PubMed1995

Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line.

Insulin-like growth factor-binding protein-1 (IG-FBP-1) is the major secretory protein of decidualized human endometrium. To understand IGFBP-1 gene regulation in human endometrium, we studied the IGFBP-1 gene promoter activity in human endometrial adenocarcinoma cell line HEC-1B. Previously, we have reported that a 105-base pair (bp) ClaI/RsaI fragment, from -2732 to -2628, of IGFBP-1 promoter enhances promoter activity by 10-fold in HEC-1B cells. In this study we have characterized the activation of IGFBP-1 promoter by this distal regulatory sequence. Transient transfection assays with deletion constructs demonstrated that the activating cis-elements were located in a 59-bp fragment, from -2686 to -2628, which enhanced promoter activity 50-fold. Transient transfections and gel mobility shift assays with oligo-directed mutants revealed three cis-elements within this 59-bp region: I) ATGGGTGGGA (-2675 to -2666), II) GCTGAGCAAGTGCACAACTATCC (-2660 to -2638), and III) AGGGCGGAGT (-2637 to -2628). In nuclear extracts of HEC-1B cells, at least two proteins bound to cis-element III, one of which was transcription factor Sp1 since antibody against Sp1 caused a supershift in a gel mobility shift assay. A protein with a molecular mass of approximately 100 kilodaltons bound to cis-element I as revealed by Southwestern blotting. An unidentified protein bound to cis-element II. Mutations in cis-element I, II, and III reduced promoter activity by 37%, 86%, and 88%, respectively, indicating that there was a synergistic function among these three cis-elements.(ABSTRACT TRUNCATED AT 250 WORDS)

Adenocarcinoma↗
PubMed1995

[An experimental study on the integrated effects of heat-cleaning and detoxifying drugs and fire-purging drugs used in combination].

Heat-cleaning and detoxifying drugs and fire-purging drugs used in combination have been proved able to restore the endotoxin-induced deviant of HCT, blood viscositites, PTT and fibrinolytic activity, and reduce the blood content of both endotoxin and PGE2 in rabbits. In addition, the combination can also decrease the pes swelling percentage in rats as well as evans blue extravasation volume in mice. In practice, however, it should be noted that the bitter and cold qualities of these two kinds of drugs may be harmful to health.

Albumins↗
PubMed1995

[The effect of retinoic acid on cell membrane and metastatic ability of mouse forestomach carcinoma cells].

We studied the effect of all-trans-retinoic acid (RA) on the expression of several surface lectin receptors and cell membrane fluidity of mouse forestomach carcinoma cell line (MFC) in vitro. The results showed that cells treated with RA manifested decreased expression of lectin receptors, increased membrane fludity and reduced spontanous metastasis. These rusults suggest that the effect of RA on tumor cell membrane may be one of the mechanisms involved in the alternation of cell metastatic phenotype.

Animals↗
PubMed1995

The interrelationship between tumor cells' electrophoretic mobility, adhesive and invasive abilities, and their metastatic potential.

Investigations on the relationship between some tumor cell properties and their metastatic potential using different clones from two tumor cell lines are reported. CNE2L2 (highly metastatic) and CNE2L4 (low metastatic) clones were isolated from human nasopharyngeal carcinoma CNE-2Z cell line. LA1, LAD and LA5 clones were isolated from mouse pulmonary adenocarcinoma offLA795 cell line with different metastatic potentials. The results from both cell lines showed that the metastatic potential of tumor cells positively correlated with electrophoretic mobility rate, adhesion with endothelial cells and in vitro and in vivo invasiveness, and negatively correlated with self-adhesion and adhesion to fibroblast cells. The data further confirmed the relationship between these factors and the metastatic potential of tumor cells.

Adenocarcinoma↗
PubMed1995

[Studies on mode of human infection with Echinochasmus liliputanus].

Epidemiological survey and experimental studies on the mode of human infection with Echinochasmus liliputanus were carried out in Chenqiaozhou Village, Hexian County, Anhui Province in 1992. The results showed that humans could be infected through drinking unboiled water containing E.liliputanus cercaria or eating raw fish containing the metacercaria. The infection rates of E. liliputanus were 1.5% in the inhabitants who did not drink raw water, and 20.1% in those who used to drink raw water. It was only the cercaria, not the metacercaria that was detected in the water from ponds of this village. None of the investigated inhabitants ate uncooked fish. The results indicated that drinking raw water containing E.liliputanus cercaria was a major way through which a humans were infected and eating food containing the metacercaria was a minor mode of human infection.

Animals↗
PubMed1995

[Effect of RII on the biological properties of human nasopharyngeal carcinoma cell lines].

N(4-hydroxycarbophenyl) retinamide (RII) is a new synthetic analog of retinoids with low toxicity. Its effect on the biological properties associated with tumor malignant behavior of human nasopharyngeal carcinoma cell lines (HNCs), including CNE-2Z parent cell lines and their variants L2, H2, L4 was studied. RII (10(-5) mol/L) caused detectable morphologic differentiation of HNCs. It inhibited growth of HNCs in vitro and decreased ability of these cells to penetrate matrigel-coated filters by using a reconstituted basement membrane invasion assay. These results suggested that RII might be a kind of useful anticancer drug.

Antineoplastic Agents↗
PubMed1995

[Treatment of advanced malignant tumor in children: delayed primary and secondary operation].

25 children with advanced malignant tumor (neuroblastoma 12, Wilm's tumor 4, rhabdomyoblastoma 7, embryonic carcinoma 2) were treated with delayed primary or secondary operation. The preoperative chemotherapy lasted for 1.03 approximately 9.06 months (mean 3.58 months). It reduced the size of the tumor by 10.5% approximately 95.2% (mean 69.5%), while the resectability was 84%. The patients with delayed or secondary operation survived for 18.25 +/- 9.32 months, a significant prolongation, compared to those underwent primary operation in the control group (7.23 +/- 6.38 months). The indication for the delayed or secondary operation was discussed. From these results, it is concluded that both resectability and survival of the children with advanced malignant tumors have been improved by the combination of chemotherapy and delayed primary or secondary operation.

Antineoplastic Combined Chemotherapy Protocols↗
PubMed1995

[Identification of transcription start site of waxy gene in O. sativa subsp. indica 232].

Analysis of Northern blot and the cDNA sequence of rice waxy gene showed that the transcript of rice waxy gene may extend beyond 1.2kb upstream of the tranlation start site. So a 21 nts oligonucleotide was designed as primer. The transcription start site of the waxy gene in O. sativa subsp. indica 232 cultiva was determined by primer extension reaction with the endosperm RNA of indica 232 as template. The context sequence of transcription start site, CTCACCA, fits well with the consensus sequence CTCATCA from higher plant genes with only one base change. The transcription start site of F. spontanea No. 1 waxy gene and the putative TATA boxs of two rices are discussed by comparison of sequence.

Base Sequence↗
PubMed1994

Determination of the effective charge of a protein in solution by capillary electrophoresis.

This paper describes two methods to estimate the effective charge of a protein in solution by capillary electrophoresis and demonstrates these methods by using representative proteins. In one method, a "charge ladder"--a series of derivatives of a protein differing by known increments of charge but differing only minimally in hydrodynamic drag--is generated by covalent modification of the epsilon-amino groups of lysines with 4-sulfophenyl isothiocyanate or acetic anhydride. In the second method, the equivalent of a charge ladder is produced by noncovalent association of a protein with differently charged ligands. Analysis of the electrophoretic mobilities of the protein and its derivatives as a function of added charge allows the effective charge to be estimated for the unmodified protein. This type of analysis permits estimation of the effective charge of a protein without knowing its composition, structure, or amino acid sequence.

Acetic Anhydrides↗
PubMed1994

Glucose transport activity in skeletal muscles from transgenic mice overexpressing GLUT1. Increased basal transport is associated with a defective response to diverse stimuli that activate GLUT4.

Glucose transport activity was examined in transgenic mice overexpressing the human GLUT1 glucose transporter in skeletal muscles. Basal transport activity measured in vitro with the glucose analog 2-deoxy-D-glucose (1 mM) was increased 2-8-fold in four different muscle preparations. Incubation of muscles from control nontransgenic littermates with a maximally effective concentration of insulin or with insulin-like growth factor-1 resulted in glucose transport rates that were 2-3-fold higher than basal. In contrast, insulin did not stimulate glucose transport activity in three different muscle preparations from transgenic animals; insulin-like growth factor-1 was similarly ineffective. Activation of System A amino acid transport activity (measured with the nonmetabolizable analog alpha-methylaminoisobutyrate) by insulin was not impaired in muscles from transgenic mice, indicating that the defect does not involve the insulin receptor. In skeletal muscle, glucose transport can be activated by muscle contractions or hypoxia via a pathway separate from that activated by insulin. Incubation of muscles under hypoxic conditions or stimulation of muscles to contract in situ did not increase glucose transport activity in muscles from GLUT1-overexpressing mice, in contrast to the stimulatory effects measured in muscles from control animals. These data suggest that increased glucose flux per se into skeletal muscle results in resistance of GLUT4 to activation by insulin and various other stimuli that activate glucose transport by mechanisms distinct from that of insulin. GLUT1-overexpressing mice thus provide a new model system for studying the effects of glucose-induced resistance to activation of glucose transport.

Amino Acids↗
PubMed1994

Regulation of the beta-stimulation of the Na(+)-K+ pump current in guinea-pig ventricular myocytes by a cAMP-dependent PKA pathway.

1. The whole-cell patch-clamp technique was employed with the free intracellular [Ca2+] fixed at 1.4 microM in order to study the isoprenaline (Iso)-induced increase in the Na(+)-K+ pump current (Ip) in acutely isolated guinea-pig ventricular myocytes. 2. The non-specific protein kinase inhibitor, H-7, eliminated the stimulatory effect of Iso, suggesting a phosphorylation step is involved in the beta-agonist stimulation of Ip. 3. H-7 or the phosphatase inhibitor calyculin A individually had no effect on basal Ip; however, when Ip was first increased by Iso, H-7 inhibited and calyculin A further increased Ip. This suggests phosphorylation is not important to the basal regulation of Ip, but does have an effect during beta-stimulation. 4. The Iso-induced increase in Ip could be mimicked by adding the membrane-permanent cAMP analogue chlorophenylthio-cAMP, blocking cAMP degradation with IBMX or stimulating cAMP production with forskolin. Alternatively the protein kinase A inhibitor PKI blocked the stimulatory effect of Iso. This suggests the Iso-induced phosphorylation responsible for increasing Ip is mediated by cAMP, which then activates protein kinase A (PKA). 5. We conclude that the beta-agonist-induced increase in Ip in the presence of high intracellular [Ca2+] is mediated by a phosphorylation step via the cAMP-dependent PKA pathway. During beta-stimulation, this increase in active Na(+)-K+ transport can serve to offset the effects of increases in passive membrane conductances.

1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine↗