Search PubMed⌕ Search

Biomedical subjects

J Emery

Publications and source records attributed to J Emery.

At least 55 records · Page 3Linked to original sources

scratch, a pan-neural gene encoding a zinc finger protein related to snail, promotes neuronal development.

The Drosophila scratch (scrt) gene is expressed in most or all neuronal precursor cells and encodes a predicted zinc finger transcription factor closely related to the product of the mesoderm determination gene snail (sna). Adult flies homozygous for scrt null alleles have a reduced number of photoreceptors in the eye, and embryos lacking the function of both scrt and the pan-neural gene deadpan (dpn), which encodes a basic helix-loop-helix (bHLH) protein, exhibit a significant loss of neurons. Conversely, ectopic expression of a scrt transgene during embryonic and adult development leads to the production of supernumerary neurons. Consistent with scrt functioning as a transcription factor, various genes are more broadly expressed than normal in scrt null mutants. Reciprocally, these same genes are expressed at reduced levels in response to ectopic scrt expression. We propose that scrt promotes neuronal cell fates by suppressing expression of genes promoting non-neuronal cell fates. We discuss the similarities between the roles of the ancestrally related scrt, sna, and escargot (esc) genes in regulating cell fate choices.

Amino Acid Sequence↗

Dorsal-ventral patterning of the Drosophila embryo depends on a putative negative growth factor encoded by the short gastrulation gene.

Pattern formation in the dorsal region of the Drosophila embryo depends on the activity of a small group of zygotically acting genes. dpp, a key gene in this group, encodes a TGF-beta-like product (Dpp) that has been proposed to function as a morphogen with peak levels of Dpp-specifying amnioserosa, the dorsal-most cell type, and lower Dpp levels specifying dorsal ectoderm. The short gastrulation gene also contributes to patterning the dorsal region, but unlike the other genes involved in this process, sog activity is only required in ventral cells. Genetic evidence indicates that sog functions to antagonize dpp activity. In this report we present further phenotypic characterization of sog mutant embryos in dorsal and lateral regions and describe the cloning of the sog locus. sog is expressed in a broad lateral stripe of cells that abuts the dorsal territory of dpp-expressing cells. sog is predicted to encode a protein with an internal signal sequence and a large extracellular domain containing four repeats of a novel motif defined by the spacing of 10 cysteine residues that is distantly related to domains present in thrombospondin and procollagen. We propose that one or more of these cysteine repeats can be liberated by proteolytic cleavage of the primary Sog protein. These putative soluble Sog peptides may then diffuse into the dorsal region to antagonize the activity of Dpp, leading to the subdivision of the dorsal territory into amnioserosa and dorsal ectoderm.

Amino Acid Sequence↗

Cortical hyperostosis: a complication of prolonged prostaglandin infusion in infants awaiting cardiac transplantation.

BACKGROUND: Infants awaiting heart transplantation for congenital heart disease frequently require prostaglandin E1 (PGE1) infusion for prolonged periods. As a result, complications of prolonged PGE1 infusion, such as cortical hyperostosis, are being encountered more commonly. OBJECTIVE: To determine the incidence and severity of cortical hyperostosis in newborns requiring prolonged PGE1 infusion. METHODS: Chest radiographs of 86 infants receiving PGE1 infusion awaiting heart transplantation were reviewed. The chest radiographs were graded for the severity of cortical hyperostosis (no bony changes, minimal hyperostosis, or severe hyperostosis). Duration of PGE1 infusion, total PGE1 dose, and highest alkaline phosphatase were recorded for each patient. Infants were arbitrarily divided into three groups according to the duration of PGE1 infusion (< 30 days, 30 to 60 days, > 60 days). RESULTS: Fifty-three of the 86 infants (62%) had radiologic evidence of cortical hyperostosis. Forty-two of 80 infants (53%) had elevated alkaline phosphatase. The percentage of infants with hyperostosis increased with increasing duration of PGE1 infusion (42% at < 30 days; 87% at 30 to 60 days; 100% at > 60 days). The incidence and severity of cortical hyperostosis were related (by Kruskal-Wallis) to the duration of PGE1 infusion (P < .0001) and the total dose of PGE1 received (P < .0001). The highest alkaline phosphatase levels were observed in infants with the most severe grades of hyperostosis (P < .0001). The percentage of infants with elevated alkaline phosphatase increased with greater severity of hyperostosis (26% of infants with no bony changes, 59% with minimal changes, and 85% with severe changes). Two infants had symptomatic bone tenderness or swelling mimicking osteomyelitis. CONCLUSION: It is concluded that cortical hyperostosis is a frequent, often asymptomatic, side effect of prolonged PGE1 infusion that should be evaluated in any infant on long-term PGE1 therapy. When symptoms occur in infants awaiting transplantation, osteomyelitis must be excluded rapidly to avoid an unnecessary delay in transplantation.

Alprostadil↗

Comparison of the accuracy of computerized videokeratography and keratometry for use in intraocular lens calculations.

We compared the accuracy of keratometry and computerized videokeratography (CVK) for use in intraocular lens calculations. We studied 48 eyes of 45 patients having phacoemulsification and posterior chamber lens implantation. Computerized videokeratography was performed with the EyeSys Corneal Analysis System (ECAS). Using the SRK II, SRK/T, and Holladay formulas, we evaluated predictive accuracy calculated with keratometric values and four values derived from ECAS measurements. For each formula, the use of one of the CVK parameters resulted in lower mean absolute errors between actual and predicted postoperative refractive errors and higher percentages of cases with power prediction errors < 0.5 and < 1.0 diopters. Computerized videokeratography may provide a more accurate corneal curvature value than keratometry for use in intraocular lens calculations.

Cataract Extraction↗

The comparative costs of care using apnoea monitors and scales in families with a cot death.

This paper reports the findings from a programme, which provided support to families with a subsequent baby following a cot death. One hundred families participated in the study. Fifty families were randomly allocated apnoea monitors, and the remainder provided with scales and weight charts for daily weighing. The results show that the parents in both groups expressed equal satisfaction with their designated method. However, compared with families allocated scales, those using apnoea monitors attended the child health clinics more often, and the number of contacts with the paediatrician was increased. They also had slightly more home and general practitioner contacts and hospital admissions. The capital and running costs of providing monitors was also greater for this group.

Apnea↗

A method for continuous monitoring of the ground reaction force during daily activity.

Theoretical models and experimental studies of bone remodeling have identified peak cyclic force levels (or cyclic tissue strain energy density), number of daily loading cycles, and load (strain) rate as possible contributors to the bone modeling and remodeling stimulus. To test our theoretical model and further investigate the influence of mechanical forces on bone density, we have focused on the calcaneus as a model site loaded by calcaneal surface tractions which are predominantly determined by the magnitude of the external ground reaction force (GRF). During daily activity the body is subjected to a random external loading history supplied primarily by the GRF consisting of body weight (BW) plus inertial forces (related to intensity of activity) accelerating the body center of mass. We have hypothesized that monitoring the vertical component of the GRF (GRFz) may provide a useful method of quantifying activity level in order to investigate the influence of mechanical forces on muscle and bone. GRF loading histories among individuals are known to vary greatly in peak force levels and daily cycles and we suggest these differences may be reflected in differences in lower limb musculoskeletal properties. We report here development of instrumentation to monitor the vertical component of the ground reaction force during normal daily activity.

Biomechanical Phenomena↗

Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor.

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner. The alpha-actin TRE bound TR alpha dimers cooperatively. Mutagenesis of the alpha-actin TRE indicated that the core binding motifs and the gap sequences were the most important for efficient binding to TR alpha. The retinoid X receptor alpha (RXR alpha) interacted with the alpha-actin TRE in a sequence specific fashion and formed heterodimeric complexes with TR alpha on the alpha-actin TRE. However, increased levels of RXR alpha decreased the binding of TR alpha to the alpha-actin TRE, in contrast to promoting TR alpha binding to the alpha-myosin heavy chain TRE. Furthermore, the alpha-actin, palindromic, synthetic direct repeat, alpha-myosin heavy chain, and growth hormone TREs interacted with an identical nuclear factor in vitro in muscle cells. In conclusion, our data suggest that the human skeletal alpha-actin TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

Actins↗

Tissue-specific expression of the skeletal alpha-actin gene involves sequences that can function independently of MyoD and Id.

The skeletal alpha-actin gene is a member of the sarcomeric contractile protein gene family and is specifically expressed in differentiated muscle. The skeletal alpha-actin gene is regulated efficiently by enhancer and regulatory sequences between nucleotide positions -1282 and -87. In the present study we have shown that the sequences 3' of nucleotide position -87 can functionally interact with the SV40 enhancer in a tissue-specific manner and can restrict the ubiquitous function of the SV40 enhancer to myogenic cells. Site-specific cassette mutagenesis was used to delimit the sequences upstream of the TATA motif (-32), between nucleotide positions -64 and -37, that mediate efficient expression in myogenic cells in the presence of the SV40 enhancer. The skeletal alpha-actin promoter was trans-activated by the helix-loop-helix (HLH) transcription factors MyoD, MRF-4, and Myogenin, in pluripotential 10T1/2 fibroblasts and trans-repressed by the HLH protein Id (inhibitor of differentiation) in myogenic C2C12 cells. This trans-regulation required sequences upstream of -87 and occurred independently of the two consensus E boxes (CANNTG) at positions +18 and +71. The -64/-37 region interacted with purified Sp1 and an unidentified protein(s), proximal regulatory factor(s) I (PRF-I). We conclude that the muscle-specific expression of the skeletal alpha-actin promoter is not simply determined by MyoD elements and enhancer and regulatory sequences, but that the minimal promoter contains important determinants of cell-specific transcription that can function independently of the helix-loop-helix transcription factors.

Actins↗

Proliferin, a prolactin/growth hormone-like peptide represses myogenic-specific transcription by the suppression of an essential serum response factor-like DNA-binding activity.

Proliferin (PLF), a protein which has homology to PRL and GH, has been implicated in the regulation of cell growth and differentiation. PLF1 was detected and found to be differentially regulated during myogenesis in the rodent myogenic cell line C2C12. Transient and stable constitutive high level expression of PLF1 repressed expression of the transfected cardiac and skeletal alpha-actin myogenic-specific promoters, but did not affect expression of the cytoskeletal beta-actin and several viral promoters linked to CAT. Stable cotransfection analyses of 5' unidirectionally deleted actin promoters and a PLF expression vector indicated that PLF exerted its effect on transcription down-stream of nucleotide positions -177 and -154 with respect to the start of transcription at 1 in the cardiac and skeletal alpha-actin promoters. Analyses of cells stably transfected with PLF showed reduced levels of MyoD mRNA, a recently identified gene that is sufficient to convert pluripotential 10T1/2 cells into myoblasts. However, transient constitutive expression of MyoD by the Moloney sarcoma virus long terminal repeat did not override the effect of PLF. Electrophoretic mobility shift analysis of nuclear extracts from C2C12 cells stably transfected with a PLF expression vector displayed drastically reduced levels or activity of the CArG-binding factor (CBF) relative to the ubiquitously expressed transcription factor Oct-1. High affinity interaction between CBF and alpha-actin promoter sequences in vitro directly correlates with functional in vivo expression. CBF is a transcription factor that is sufficient and necessary for myogenic-specific transcription, interacts with the promoter sequences targeted by PLF, and is immunologically related to the serum response factor. In conclusion, PLF selectively represses myogenic-specific transcription within the actin multigene family by suppressing the level and/or activity of a trans-acting factor (CBF) that modulates multiple muscle-specific genes. The data provide a molecular explanation for the inhibition of differentiation by an endogenously produced growth factor/hormone that is differentially expressed during myogenesis and a physiologically important antagonistic regulator of muscle-specific transcription.

Actins↗

[Thrombotic thrombocytopenic purpura and human acquired immunodeficiency virus seropositivity].

Thrombotic thrombocytopenic purpura (TTP) is a rare disorder of unknown etiology, clinically characterized by a diagnostic pentad (thrombocytopenia, microangiopathic hemolytic anemia, neurologic signs and symptoms, fever and renal damage). Recent reports in the medical literature have described its association with the human immunodeficiency virus (HIV). We report such a case in a woman admitted with TTP in whom HIV seropositivity was found. The histopathologic findings in biopsies and autopsy confirmed the clinical diagnosis of TTP: disseminated microthrombosis in arterioles and capillaries.

Biopsy↗

[Adhesion, contribution to full denture retention: experimental research on resin surface energy].

The authors propose a study of the surface energy of dental resins. The two liquids measure method, by means of water and alkanes enables to determine the dispersive and polar components of this energy and therefore to understand what types of bindings may be altered in the process of various physical or chemical treatments of the surface of the material. Treatment by alcoholic potash, or immersion of the resin in water, increase the polar component of surface energy by inducing a re-orientation of polymer molecules along the interface between P.M.M.A. and water. This improvement is not reversible. It reaches its maximum towards the eighth day of immersion in water. It cannot be obtained in saliva, a feebly polar medium. After a temporary increase towards the third day, the dispersive component of surface energy falls back approximately to its initial value. This treated resin can no longer be considered as a low energy solid. All comparative experimentation on the surface energy of prosthetic materials ought to be made on resin treated by water immersion.

Acrylic Resins↗

Statistical "biases" in respiratory disability determinations.

The manner in which pulmonary function test results are employed in the assessment of respiratory disability may be affected by 4 statistical choices: (1) choice of prediction equation(s), (2) adjustment factors (such as sex and race), (3) criterion values, and (4) method of comparison of observed to predicted normal test values. The records of 900 respiratory disability applicants were employed to estimate the direction and magnitude of the effect of these choices on the overall number of persons who would be declared "disabled" and upon the manner in which personal characteristics (e.g., sex, race, height, age) affect the likelihood of being declared "disabled." Choice of prediction equation had minor effects, and adjustment for race and sex had more significant effects. Choice of criterion value affected the overall number and, in certain instances (e.g., Social Security Disability Insurance), the distribution of "disability" declarations. Method of comparison (percent of predicted, difference of predicted minus observed or minimal value criterion) had major effects upon the distribution of "disability" declarations between population subgroups. Preliminary analysis therefore suggests that these statistical choices should be carefully manipulated in the design of a disability system to facilitate achievement of the system's goals.

Age Factors↗

Evidence of duration and type of illness in children found unexpectedly dead.

The thymus, rib, and liver from a series of 200 children found unexpectedly dead showed that in over 90% of these children the costochondral junction indicated that a retardation in growth velocity had preceded death. In a similar proportion of children the liver showed fatty change indicating a metabolic upset, which in 5% was of severe degree. Changes in the thymus compatible with a normal reaction to infection were observed in only a little over half of the child deaths. An absence of gross thymic reaction in some children in whom there was other evidence of infection suggests that in some an abnormal immunological reaction was taking place. It is concluded that careful systematic clinical monitoring of growth in these children would have shown abnormality in nearly all.

Fatty Liver↗

The GRAIDS Trial: the development and evaluation of computer decision support for cancer genetic risk assessment in primary care.

The development and evaluation of computer decision support for the assessment of cancer genetic risk in primary care is reported with two series of studies described: the RAGs (Risk Assessment in Genetics) studies and the GRAIDS (Genetic Risk Assessment in an Intranet and Decision Support) Trial. In the GRAIDS Trial, 45 general practices in Eastern England have been recruited and randomised. Comparison practices attend an educational session and receive clinical guidelines about familial breast and colorectal cancer. In the intervention practices a lead clinician is trained in cancer genetics and use of the GRAIDS software. The GRAIDS software is a simple pedigree-drawing program that implements clinical guidelines for familial breast and colorectal cancer and presents individualised information about breast cancer risk in a range of formats. Outcome measures of the trial include: frequency of software use, practitioners' attitudes towards the software, total number of referrals to secondary care about familial cancer and the proportion that meet regional referral criteria, and a patient-centred measure of informed decision making. The family history will become an increasingly important tool in primary care to assess genetic risk. This research evaluates an approach to support high-quality advice about cancer genetics in primary care which could be applied more broadly as our understanding of complex disease genetics increases.

Attitude of Health Personnel↗