Search PubMed⌕ Search

Biomedical subjects

J Dai

Publications and source records attributed to J Dai.

At least 73 records · Page 4Linked to original sources
PubMed2000

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Androgens↗
PubMed2000

Neutral endopeptidase promotes phorbol ester-induced apoptosis in prostate cancer cells by inhibiting neuropeptide-induced protein kinase C delta degradation.

Phorbol esters induce apoptosis in androgen-sensitive LNCaP cells, which express neutral endopeptidase (NEP), but not in androgen-independent prostate cancer (PC) cells, which lack NEP expression. We investigated the role of NEP in PC cell susceptibility to 12-O-tetradecanoylphorbol-13-acetate (TPA). Western analysis showed that expression of NEP and protein kinase Cdelta (PKCdelta) correlated with PC cell sensitivity to TPA-induced growth arrest and apoptosis in LNCaP cells and in TSU-Prl cells expressing an inducible wild-type NEP protein. Inhibition of NEP enzyme activity using the specific NEP inhibitor CGS24592, or inhibition of PKCdelta using Rottlerin at concentrations that inhibit PKCdelta but not PKCalpha, significantly inhibited TPA-induced growth inhibition and cell death. Furthermore, pulse-chase experiments showed PKCdelta is stabilized in LNCaP cells and in TSU-Pr1 cells overexpressing wild-type NEP compared with PC cells lacking NEP expression. This results from NEP inactivation of its neuropeptide substrates (bombesin and endothelin-1), which in the absence of NEP stimulate cSrc kinase activity and induce rapid degradation of PKCdelta protein. These results indicate that expression of enzymatically active NEP by PC cells is necessary for TPA-induced apoptosis, and that NEP inhibits neuropeptide-induced, cSrc-mediated PKCdelta degradation.

Amino Acid Sequence↗
PubMed2000

The human ARHI tumor suppressor gene inhibits lactation and growth in transgenic mice.

ARHI is a novel imprinted tumor suppressor gene. To study its function in vivo, we have developed transgenic mice that overexpress ARHI. Offspring bearing the transgene had significantly lower body weights than did nontransgenic littermates. In addition, strong expression of the ARHI transgene was associated with greatly impaired mammary gland development and lactation, failure of ovarian folliculogenesis resulting in decreased fertility, loss of neurons in the cerebellar cortex, and impaired development of the thymus. Decrease in body size and defects in the mammary glands correlated with the level of transgene expression. Immunohistochemical analysis indicated that expression of prolactin (PRL), but not growth hormone, was lower in the pituitary glands of mice with defective mammary gland development. The defect in pregnancy-associated mammary tissue proliferation was associated with decreased serum PRL and progesterone levels. Moreover, lower levels of estrogen receptor and progesterone receptor were observed in postpartum mammary glands and in the ovaries of mice that overexpressed ARHI. Our data suggest that ARHI can inhibit PRL secretion and act as a negative regulator in murine growth and development.

Animals↗
PubMed2000

R(+)-8-OH-DPAT, a selective 5-HT(1A) receptor agonist, attenuated amphetamine-induced dopamine synthesis in rat striatum, but not nucleus accumbens or medial prefrontal cortex.

R(+)-8-OH-DPAT (0.05, but not 0.025, 0.1, 1 mg/kg), a 5-HT(1A) receptor agonist, decreased l-3,4-dihydroxyphenylalanine (DOPA) accumulation in rat striatum following NSD-1015, an l-aromatic amino acid decarboxylase inhibitor. Amphetamine (1 mg/kg) increased striatal DOPA accumulation, an effect attenuated by R(+)-8-OH-DPAT (0.05 mg/kg). However, both amphetamine (1 mg/kg) and R(+)-8-OH-DPAT (0.05 mg/kg) decreased cortical DOPA accumulation; there were no additional decreases from their combination. Neither amphetamine (1 mg/kg), R(+)-8-OH-DPAT (0.05 mg/kg), or the combination, significantly affected DOPA accumulation in the nucleus accumbens. The significance of and possible mechanisms for these findings are discussed.

8-Hydroxy-2-(di-n-propylamino)tetralin↗
PubMed2000

Identification by mutagenesis of conserved arginine and tryptophan residues in rat liver carnitine palmitoyltransferase I important for catalytic activity.

Carnitine palmitoyltransferase I catalyzes the conversion of long-chain acyl-CoA to acylcarnitines in the presence of l-carnitine. To determine the role of the conserved arginine and tryptophan residues on catalytic activity in the liver isoform of carnitine palmitoyltransferase I (L-CPTI), we separately mutated five conserved arginines and two tryptophans to alanine. Substitution of arginine residues 388, 451, and 606 with alanine resulted in loss of 88, 82, and 93% of L-CPTI activity, respectively. Mutants R601A and R655A showed less than 2% of the wild type L-CPTI activity. A change of tryptophan 391 and 452 to alanine resulted in 50 and 93% loss in carnitine palmitoyltransferase activity, respectively. The mutations caused decreases in catalytic efficiency of 80-98%. The residual activity in the mutant L-CPTIs was sensitive to malonyl-CoA inhibition. Mutants R388A, R451A, R606A, W391A, and W452A had no effect on the K(m) values for carnitine or palmitoyl-CoA. However, these mutations decreased the V(max) values for both substrates by 10-40-fold, suggesting that the main effect of the mutations was to decrease the stability of the enzyme-substrate complex. We suggest that conserved arginine and tryptophan residues in L-CPTI contribute to the stabilization of the enzyme-substrate complex by charge neutralization and hydrophobic interactions. The predicted secondary structure of the 100-amino acid residue region of L-CPTI, containing arginines 388 and 451 and tryptophans 391 and 452, consists of four alpha-helices similar to the known three-dimensional structure of the acyl-CoA-binding protein. We predict that this 100-amino acid residue region constitutes the putative palmitoyl-CoA-binding site in L-CPTI.

Amino Acid Sequence↗
PubMed2000

Interleukin 18 and interleukin 1beta production is decreased in HIV type 1-seropositive hemophiliacs but not in HIV type 1-seropositive nonhemophiliacs.

In Japan, the proportion of hemophiliacs infected with human immunodeficiency virus type 1 (HIV-1) is 40%, whereas more than 90% are infected with hepatitis C virus (HCV). To evaluate the immunological status of hemophiliacs infected with HIV-1, we investigated the pattern of cytokine production in peripheral blood mononuclear cells (PBMCs) of HIV-1-seropositive and -seronegative hemophiliacs, HIV-1-seropositive non-hemophiliacs, and healthy individuals. The production of IL-18 and IL-1beta from PBMCs stimulated with Staphylococcus aureus Cowan strain 1 (SAC) in the HIV-1-seropositive hemophiliacs was significantly decreased in comparison with the other groups. On the other hand, IL-12 production in both HIV-1-seropositive groups was significantly lower than in HIV-1-seronegative groups. TNF-alpha and IL-6 production was similar among the four groups. In contrast, plasma levels of TGF-beta1 were increased in HIV-1-seropositive hemophiliacs, HIV-1-seropositive nonhemophiliacs, and HIV-1-seronegative hemophiliacs, with the highest levels being in HIV-1-seropositive hemophiliacs, suggesting that coinfection with HIV-1 and HCV increases the level of plasma TGF-beta in HIV-1-seropositive hemophiliacs. Treatment of PBMCs from healthy individuals with TGF-beta1 inhibited IL-18 and IL-1beta production without affecting IL-6, IL-10, or TNF-alpha production. Suppression of the expression of caspase 1 mRNA, which is known to be an IL-1beta-converting enzyme and which also cleaves the precursor of IL-18, was observed in the SAC-stimulated PBMCs from healthy individuals after treatment with TGF-beta1 and in the SAC-stimulated PBMCs from HIV-1-seropositive hemophiliacs, suggesting that the decreased production of IL-18 and IL-1beta in HIV-1-seropositive hemophiliacs may be related to the downregulation of caspase 1 mRNA induced by high levels of TGF-beta1 in plasma.

Adolescent↗
PubMed2000

Application of Live Monocells from Macroalgae to Shellfish Seed Production.

Monocells were isolated from several macroalgae, Porphyra yezoensis, Undaria pinnatifida, and Laminaria japonica, by digestion with alga-tool enzymes. The monocells were then used to feed the parents or larvae of bay scallop Argopecten irradians, blood cockle Arca inflata, and abalone Haliotis discus juveniles. Results showed that the parents of bay scallop and blood cockle fed with Porphyra monocells could mature and discharge eggs and spermatozoa and their larvae could metamorphose; the survival rate of abalone juveniles fed with isolated cells from Laminaria and Undaria increased by 100% compared with that of those fed with artificial food.

Journal Article↗
PubMed2000

Differential responsiveness of MCF-7 human breast cancer cell line stocks to the pineal hormone, melatonin.

The estrogen receptor (ER)-positive MCF-7 human breast cancer cell line has been used extensively for the study of estrogen-responsive human breast cancer. However, various levels of estrogen responsiveness have been described in different stocks of MCF-7 cells. Because we have previously shown that the pineal hormone, melatonin, inhibits proliferation of MCF-7 cells and can modulate ER expression and transactivation, we investigated if various stocks of MCF-7 cells exhibit a differential responsiveness to the anti-proliferative effects of melatonin and the possible mechanisms involved. The MCF-7 stocks (M, O, H) were examined for: (1) mitogenic response to estradiol; (2) steady-state ER mRNA levels; (3) expression of the mt1 melatonin membrane receptor; (4) growth inhibition by melatonin; and (5) melatonin's modulation of expression of the ER and the estrogen-regulated genes, PgR, TGFbeta and pS2. For all of these parameters, there was a stock-specific response which showed: MCF-7M > MCF-7O > MCF-7H. These results demonstrate that there are significant differences in the responsiveness of various stocks of MCF-7 breast cancer cells to the growth-inhibitory effects of melatonin which can be correlated with both the level of ER mRNA expression and the degree of estrogen-responsiveness. These findings suggest that not only may these differences have some impact on the cells' estrogen-response pathway, but also that the primary growth-inhibitory effects of melatonin are transduced through the membrane-associated G-protein coupled mt1 melatonin receptor.

Blotting, Northern↗
PubMed2000

Selection and determination of beam weights based on genetic algorithms for conformal radiotherapy treatment planning.

A genetic algorithm has been used to optimize the selection of beam weights for external beam three-dimensional conformal radiotherapy treatment planning. A fitness function is defined, which includes a difference function to achieve a least-square fit to doses at preselected points in a planning target volume, and a penalty item to constrain the maximum allowable doses delivered to critical organs. Adjustment between the dose uniformity within the target volume and the dose constraint to the critical structures can be achieved by varying the beam weight variables in the fitness function. A floating-point encoding schema and several operators, like uniform crossover, arithmetical crossover, geometrical crossover, Gaussian mutation and uniform mutation, have been used to evolve the population. Three different cases were used to verify the correctness of the algorithm and quality assessment based on dose-volume histograms and three-dimensional dose distributions were given. The results indicate that the genetic algorithm presented here has considerable potential.

Adolescent↗
PubMed2000

Exact solution of the specific-heat-phonon spectrum inversion from the Mobius inverse formula

The application of the Mobius inversion formula to the specific-heat-phonon spectrum inversion problem (SPI) initially appeared promising [N.X. Chen, Phys. Rev. Lett. 64, 1193 (1990); J. Maddox, Nature (London) 344, 377 (1990)]. However, no one has previously been able to obtain the exact Debye spectrum with the correct cut-off factor and frequency dependence from the Mobius formula. The main difficulty arises from the fact that the Mobius function &mgr;(n) is not completely known for large n in practice. In this paper, some exact solutions of SPI are obtained by using the Mobius inversion formula, most importantly the Debye spectrum as a special case, and the problem of the unknown Mobius function &mgr;(n) for large n is avoided. It is shown that the Mobius inversion formula can be useful for exact solutions to spectral inversion problems.

Journal Article↗
PubMed2000

Selecting beam weight and wedge filter on the basis of dose gradient analysis.

This study proposes an algorithm for selecting beam weight, wedge angle, and wedge orientation for three-dimensional radiation therapy treatment planning. According to dose gradient analysis, the necessary and sufficient condition for achieving a homogeneous dose over the target volume is that the total vector sum of the dose gradients of all beams be zero everywhere in the target volume. This study presents equations for calculating the beam weight, wedge angle, and collimator angle (because the collimator angle determines wedge orientation when beam direction is known) for treatment plans using two angled beams or three coplanar or noncoplanar beams. It also provides suggestions for calculations of treatment plans using more than three beams, for which many feasible solutions will be available. When tested using two clinical cases, this algorithm achieved homogeneous dose distributions over target volumes. With this algorithm, repeated manual adjustments are reduced, and the quality and efficiency of treatment planning are improved.

Algorithms↗
PubMed2000

Optimizing beam weights and wedge filters with the concept of the super-omni wedge.

This study introduces a new concept, the super-omni wedge, and proposes an algorithm for optimizing beam weights, wedge angles, and wedge orientations on the basis of this new concept. The super-omni wedge is a generalization of the omni wedge. Instead of combining one open beam and two orthogonal wedged beams, it uses two orthogonal pairs of nominal wedged beams to generate a wedged dose distribution with an arbitrary wedge angle and an arbitrary wedge orientation. The orientations of a pair of nominal wedges are opposite each other. In this way, the effective wedge orientation can vary from 0 degrees to 360 degrees rather than being restricted to one quadrant. When the concept of the super-omni wedge is used, the optimization of beam weights, wedge angles, and wedge orientations for J beams is transformed into the optimization of beam weights for 4J beams. A quadratic dose-based objective function is defined, and the method of sequential quadratic programming is used to find the 4J beam weights that minimize it. After the weights of the nominal wedged beams have been determined, the beams can be delivered in one of four methods: Directly, by using the omni wedge technique, by using the universal wedge technique, and by using the virtual wedge technique. When tested with two clinical cases, the algorithm achieved homogeneous dose distributions in target volumes while meeting the constraints to the organs at risk. A prominent feature of the algorithm is that there is no need to manually preselect the orientations of nominal wedges.

Algorithms↗
PubMed2000

TNF-alpha increases tracheal epithelial asbestos and fiberglass binding via a NF-kappaB-dependent mechanism.

Tumor necrosis factor (TNF)-alpha is released from alveolar macrophages after phagocytosis of mineral fibers. To determine whether TNF-alpha affects the binding of fibers to epithelial cells, we exposed rat tracheal explants to TNF-alpha or to culture medium alone, followed by a suspension of amosite asbestos or fiberglass (MMVF10). Loosely adherent fibers were removed from the surface with a standardized washing technique, and the number of bound fibers was determined by scanning electron microscopy. Increasing doses of TNF-alpha produced increases in fiber binding. This effect was abolished by an anti-TNF-alpha antibody, the proteasome inhibitor MG-132, and the nuclear factor (NF)-kappaB inhibitor pyrrolidine dithiocarbamate. Gel shift and Western blot analyses confirmed that TNF-alpha activated NF-kappaB and depleted IkappaB in this system and that these effects were prevented by MG-132 and pyrrolidine dithiocarbamate. These observations indicate that TNF-alpha increases epithelial fiber binding by a NF-kappaB-dependent mechanism. They also suggest that mineral particles may cause pathological lesions via an autocrine-like process in which the response evoked by particles, for example, macrophage TNF-alpha production, acts to enhance subsequent interactions of particles with tissue.

Animals↗
PubMed2000

Gamma Knife radiosurgery as a primary surgical treatment for hypersecreting pituitary adenomas.

OBJECT: To estimate the efficacy of Gamma Knife radiosurgery (GKR) especially as a primary surgical treatment for hypersecreting pituitary adenomas. METHODS: 274 patients were treated with GKR. The mean tumor volume was 1.86 cm(3). The mean peripheral dose was 28.7 Gy. RESULTS: 223 patients were followed up for an average of 31.6 months. The dose related to the tumor growth control and endocrinological normalization was detailed and statistical analysis of the data was performed. CONCLUSION: GKR as a primary surgical treatment for hypersecreting pituitary adenomas may be safe and effective.

Adenoma↗
PubMed2000

The flow-cytometric analysis of nasopharyngeal carcinoma treated with stereotactic radiosurgery.

Stereotactic radiosurgery has been used in the treatment of nasopharyngeal carcinoma. To analyze the effect of radiosurgery on the flow cytometry DNA index and progression of cells through the cycles, 4 recurrent nasopharyngeal carcinoma cases were treated with stereotactic radiosurgery. The distribution of cells through the cycles was measured by flow cytometry at various times thereafter. The 50% isodose curve was placed at the tumor margin and the margin dose was 20 Gy. Biopsy of the nasopharynx was performed before and 1, 3, and 6 months after treatment. The specimens were then subjected to flow-cytometric analysis. The percentage of cells in the S phase was 27.6 +/- 1.0, 14.6 +/- 0.8, 12.1 +/- 1.6 and 11.3 +/- 1.3%; the proliferating index was 39.1 +/- 1.4, 17.0 +/- 0.9, and 14.3 +/- 1.2 and 14.1 +/- 1.5%, and the DNA index was 1.5 +/- 0.1, 1.6 +/- 0.2, 1.7 +/- 0.1 and 1.9 +/- 0.1 before and 1, 3, and 6 months after treatment, respectively. It is suggested that the percentage of cells in the S phase and the proliferating index decreased to normal after treatment with stereotactic radiosurgery. This study explores the preliminary radiobiological effect of stereotactic radiosurgery on the DNA content and the distribution of cells through the cycles in nasopharyngeal carcinoma.

Aged↗