Search PubMed⌕ Search

Biomedical subjects

J D Stobo

Publications and source records attributed to J D Stobo.

At least 37 records · Page 2Linked to original sources
PubMed1985

Regulation of expression of the human interferon gamma gene.

DNA fragments isolated from a genomic clone of human gamma interferon (IFN-gamma) as well as IFN-gamma cDNA were used to map potential regulatory regions of the IFN-gamma gene by DNase I-hypersensitivity analyses. In nuclei from the human T-cell line Jurkat, which can be induced to express the IFN-gamma gene, we observed a strongly hypersensitive site in the first intervening sequence that localized to the only intracistronic repeat element in the gene. DNase I mapping of Jurkat cells was compared to that of several other cell types, including B cells, macrophages, and epithelial cells. The presence of strong intronic hypersensitivity was found only in cells capable of expressing the IFN-gamma gene. No hypersensitivity was found in the 3' regions of the gene. Further, no hypersensitivity was observed when purified genomic DNA from Jurkat was analyzed, suggesting that DNA-protein interactions, and not simply DNA sequence alone, were responsible for DNase I hypersensitivity. The sequence AAGTGTAATTTTTTGAGTTTCTTTT, which is directly in the intronic hypersensitive area of IFN-gamma, is 83% homologous to a nearly identical sequence in the 5' flanking region of the interleukin 2 gene. In interleukin 2, the homologous sequence is about 300 base pairs upstream of that gene's promoter in an area of potential regulatory importance.

Base Sequence↗
PubMed1985

Molecular analysis of the bare lymphocyte syndrome.

The bare lymphocyte syndrome is a disorder in which class I histocompatibility antigens fail to be expressed normally on the surface of lymphocytes. Utilizing complementary DNA probes for both beta 2-microglobulin and class I genes, the molecular basis for this syndrome was investigated in a family with two siblings exhibiting the bare lymphocyte syndrome. Southern blot analysis demonstrated no gross internal defect in either class I or beta 2-microglobulin genes. Northern blot analysis of class I and beta 2-microglobulin messenger RNAs also revealed no qualitative difference between affected and unaffected family members. In contrast, quantitation of both class I and beta 2-microglobulin transcripts demonstrated each to be decreased in patients when compared to controls. Moreover, the decrease in both transcripts was coordinate. These results suggest that the bare lymphocyte syndrome may represent a pretranslational regulatory defect of both class I and beta 2-microglobulin gene expression.

Antigens, Surface↗
PubMed1985

The antigen receptor on a human T cell line initiates activation by increasing cytoplasmic free calcium.

A monoclonal antibody to the antigen-receptor on the T cell line Jurkat induces substantial increases in [Ca++]i. Ca++ ionophores can substitute for this antibody in activation by increasing [Ca++]i to levels comparable with those seen with the antigen-receptor antibody. Stimulation with either the antigen-receptor antibody or a Ca++ ionophore leads to the appearance of the same phosphoproteins. These results suggest that the antigen-receptor initiates T cell activation by increasing [Ca++]i.

Antibodies, Monoclonal↗
PubMed1985

T cell activation: differences in the signals required for IL 2 production by nonactivated and activated T cells.

Soluble antibodies against the T3/antigen receptor complex alone are not sufficient to induce proliferation and interleukin 2 expression by T lymphocytes. An additional requirement is the presence of accessory cells (AC). In this model, AC provide at least two functions required for T cell activation: 1) the surface interaction of T3 antibodies with Fc receptors on the AC surface and 2) the production of soluble mediators such as interleukin 1 (IL 1). In the experiments reported here, these stimuli are represented by T3 antibodies immobilized onto Sepharose beads and by recombinant IL 1. In this study we investigated differences in activation requirements in resting and activated T cells. Resting T cells were represented by AC-depleted peripheral blood mononuclear cells (PBMC) or the T cell line Jurkat, which phenotypically resembles a resting T cell. Activated T cells were represented by T cell clones and the T cell line HUT 78, which express the activation molecules Ia and the IL 2 receptor (Tac). In resting cells, activation required the presence of three different signals: perturbation of the T3/antigen receptor complex by T3 antibodies, surface redistribution of T3/antigen receptor complexes, and presence of IL 1. In contrast, activated T cells require only perturbation and redistribution of T3/antigen receptor complexes and not IL 1 for the induction of proliferation or IL 2 production. Possible mechanisms of intracellular signaling for these stimuli are discussed.

Antibodies, Monoclonal↗
PubMed1984

Requirement for the coexpression of T3 and the T cell antigen receptor on a malignant human T cell line.

The association between T3 and the T cell antigen receptor was examined using the T3 bearing T cell leukemic line Jurkat. A monoclonal antibody, C305, was produced, which reacted with idiotypic-like determinants expressed on Jurkat. The molecule with which this antibody reacted was a disulfide-linked heterodimer of 90 kD, composed of polypeptides of 42 and 54 kD. Thus, C305 reacted with a molecule with characteristics of the putative T cell antigen receptor described by others. A series of mutants of Jurkat, induced with ethyl methane sulfonate or radiation, was selected for T3 or antigen receptor negativity. In every instance, there was a concomitant loss of both T3 and the antigen receptor as assessed by quantitative absorption, indirect immunofluorescence, and antibody plus complement-mediated cytotoxicity. The absence of antigen receptor molecules was confirmed on diagonal gels, excluding the possibility that conformational changes of the antigen receptor on such T3-negative mutants were responsible for the failure of such mutants to react with C305. Moreover, in a mutant that expressed a marked decrease in the level of T3 expression, there was a comparable decrease in the expression of antigen receptor determinants. These results suggest that there is an obligate requirement for the coexpression of T3 and the T cell antigen receptor. Furthermore, attempts to activate such mutants with the lectin phytohemagglutinin suggested that the expression of T3 and/or the antigen receptor was required for activation of these cells.

Animals↗
PubMed1984

Anticollagen antibodies and immune response gene products in rheumatoid arthritis.

Circulating antibodies to native and denatured types I and II human and bovine collagens were assayed in patients with rheumatoid arthritis (RA), patients with other rheumatic diseases, and normal individuals. A subgroup of this population was also assayed for reactivity with typing reagents which detect determinants (MT and HLA-DR) present in human immune response gene products. The mean titers of antibodies to each collagen tested were not significantly higher in RA patients when compared with patients who had other rheumatic diseases. Although both MT3 and MT4 were significantly associated with RA, there was no significant association between the anticollagen antibodies and any MT type or HLA-DR4. These studies raise a question concerning the role of collagen antibodies in the pathogenesis of RA and suggest that genes distinct from those coding for HLA-DR may play a role in the expression of the disease.

Animals↗
PubMed1984

Differential expression of Ia molecules by human monocytes.

Human immune response genes can be divided into three distinct loci, each of which codes for three distinct families of Ia molecules: HLA-SB, HLA-DC, and HLA-DR. The tissue distribution and function of only one of these Ia molecules, HLA-DR, has been thoroughly studied. Using monoclonal antibodies, we examined the display of HLA-DR and HLA-DC molecules by adherent, human peripheral blood monocytes. The results of these studies demonstrate that although all human peripheral blood monocytes display easily detectable HLA-DR molecules, only 50% display easily detectable HLA-DC molecules. Separation of peripheral blood monocytes into HLA-DC+ and HLA-DC- cells demonstrates that each population displays an equivalent density of HLA-DR molecules. Therefore, on the basis of differences in their display of these two Ia molecules, adherent peripheral blood monocytes can be divided into two broad populations: HLA-DR+, HLA-DC+, and HLA-DR+, HLA-DC-. Despite the dis-coordinate display of these Ia antigens, the expression of both HLA-DR and HLA-DC can be regulated by a common signal, gamma interferon (IFN-gamma). Incubation of monocytes for 96 h in autologous serum leads to a marked decrease in the expression of both HLA-DR and HLA-DC. Addition of recombinant IFN-gamma to the cultures leads to reexpression of both HLA-DR and HLA-DC to levels comparable to those seen in fresh monocytes. In addition, although IFN-gamma does not modulate all monocyte surface markers, it can be demonstrated to modulate expression of one marker, MAC 120, in a manner similar to that observed for Ia antigens. These studies demonstrate that among human peripheral blood monocytes, the distribution of the Ia molecule, HLA-DC, is not coordinate with that of HLA-DR, although both respond to the same regulatory signal.

Antibodies, Monoclonal↗
PubMed1984

The role of T3 surface molecules in the activation of human T cells: a two-stimulus requirement for IL 2 production reflects events occurring at a pre-translational level.

The human T cell leukemia Jurkat was used as a model to examine the requirements of T cell activation. These studies demonstrated that antibodies reactive with the T cell-specific T3 antigen were insufficient to result in the activation of Jurkat cells, determined by the secretion of IL 2. IL 2 production occurred only in the presence of a second stimulus, the phorbol ester PMA. With the use of an IL 2-specific cDNA probe, the appearance of IL 2 RNA, similarly, occurred only when cells were stimulated with both anti-T3 antibodies and PMA. These results demonstrate a two-stimulus requirement for gene expression in human T cells.

Antibodies, Monoclonal↗
PubMed1984

Expression of HLA-DR by a human monocyte cell line is under transcriptional control.

Several studies have demonstrated that the expression of Ia molecules by macrophages is not constitutive but can be enhanced by soluble factors from activated T cells. This induced expression of Ia appears to be causally important in certain accessory functions such as antigen presentation. While the phenomenon of Ia induction is clear, the mechanism by which this occurs has not been determined. Therefore, experiments were designed to investigate the molecular events leading to expression of the human Ia molecule, HLA-DR. To accomplish this, the human monocytoid cell line U 937, which does not express any detectable HLA-DR molecules were used. Utilizing a cDNA probe for the alpha chain of HLA-DR and total cellular RNA, it could be demonstrated that resting U 937 lacked detectable HLA-DR transcripts. Digestion of genomic DNA from U 937 with the isoschizomers Msp I and Hpa II followed by analysis of the restriction fragments on Southern blots demonstrated the HLA-DR alpha chain genes to be methylated. Addition of 5-azacytidine, an analogue of cytidine which causes hypomethylation of DNA to U 937 caused hypomethylation of HLA-DR alpha chain genes but did not, by itself, lend to the appearance of HLA-DR molecules or transcripts. However, treatment of U 937 with 5-azacytidine followed by addition of either culture fluids from activated T cells or human recombinant gamma interferon did lead to the rapid appearance of abundant, mature HLA-DR transcripts and surface HLA-DR molecules. The results of these studies provide the first demonstration that methylation plays a role in the expression of human Ir genes and that induced expression of Ia molecules by soluble factors from T cells, including gamma interferon, is accompanied by the rapid appearance of Ir gene transcripts.

Cell Line↗
PubMed1983

Antigen-presenting capabilities of human monocytes correlates with their expression of HLA-DS, an Ia determinant distinct from HLA-DR.

Utilizing a monoclonal antibody (Mac-120) specific for 40 to 60% of peripheral blood adherent mononuclear cells (M phi), we were able to separate M phi into two populations based on their reactivity with the antibody. Both populations, Mac-120+ and Mac-120- cells, were then compared for a) their ability to present antigen to T cells, b) their display of HLA-DR determinants, c) their ability to stimulate in an autologous and allogeneic mixed lymphocyte reaction, and d) their display of an Ia molecule, HLA-DS, which is distinct from HLA-DR and which is homologous with murine I-A. Our findings indicate that a) only Mac-120+ cells can present antigen, b) Mac-120+ and Mac-120- cell populations are equivalent in terms of the number of HLA-DR+ cells and in the mean density of HLA-DR determinants per cell, c) although Mac-120+ and Mac-120- cells are equivalent in their ability to serve as stimulators in an allogeneic mixed lymphocyte reaction, Mac-120+ cells are better stimulators in an autologous mixed lymphocyte reaction, and d) only Mac-120+ cells display HLA-DS. These studies demonstrate that peripheral adherent mononuclear cells exhibit heterogeneity with regard to their display of Ia antigens. Furthermore, they provide functional data to support the existence of a human Ia determinant, HLA-DS, which is distinct from HLA-DR and which is important in antigen presentation and stimulation in the autologous mixed lymphocyte reaction.

Amino Acid Sequence↗
PubMed1982

The autologous mixed lymphocyte reaction in systemic lupus erythematosus.

The autologous mixed lymphocyte reaction (AMLR) represents the proliferation of T cells in response to signals from autologous non-T cells. Fractionation of the non-T population into B enriched and macrophage enriched cells demonstrated that both could serve as effective stimulator cells in the AMLR. Cytolytic treatment of both populations with a macrophage specific, monoclonal antibody abrogated stimulation of the macrophage but not the B cell population. Utilizing a series of negative selection procedures - cytolysis with T cell specific monoclonal antibody, metabolic suicide with 5-bromo-2-deoxyuridine (brdU) and light - it could be demonstrated that T cells responding to autologous macrophage were distinct from those responsive to autologous B cells. Studies of the AMLR reactivity to B cells and macrophage in a small number of patients with active systemic lupus erythematosus (SLE) demonstrated that although reactivity to both populations was diminished, the response to autologous B cells was reduced more than the response to autologous macrophage. These studies suggest that the AMLR represents the sum reactivities of two responder T cells. Moreover, they suggest that a relatively selective deficiency in only one of these cells may occur in SLE.

Antibodies, Monoclonal↗
PubMed1982

Changes in T-lymphocyte subsets during acute rheumatic fever.

Relative proportions and numbers of helper [OKT4(+)] and suppressor [OKT8(+)] peripheral blood lymphocytes were examined in 32 young patients during the acute phase of rheumatic fever. No significant decrease in percentage T cells during acute rheumatic fever was noted in comparison to normal children controls from the same population. A decrease in absolute numbers of OKT4(+) T cells was also noted in acute rheumatic subjects not receiving corticosteroids (P less than 0.05). In addition, a significant decrease was documented in both proportions and total numbers of OKT8(+) putative suppressor cells during acute rheumatic attacks. C-reactive protein binding to T-lymphocyte subsets showed no preferential reactivity in vivo for suppressor or helper T cells. Antigen-reactive T lymphocytes identified with the T29 mouse hybridoma reagent showed similar proportions and numbers in rheumatic children as were noted in controls. The present data indicate profound alterations in both helper- and suppressor-cell types in the peripheral blood profile of children with acute rheumatic fever.

Acute Disease↗
PubMed1982

Human monocytes synthesize eicosanoids from T lymphocyte-derived arachidonic acid.

T lymphocytes prelabeled with [14C] arachidonic acid failed to synthesize any eicosanoids even following stimulation with phytohemagglutinin, but they did release free [14C] arachidonic acid. Co-culture of unlabeled monocytes with the prelabeled T lymphocytes resulted in the synthesis of [14C] thromboxane B2, a major monocyte-derived eicosanoid. These data show that monocytes can utilize T lymphocyte-derived arachidonic acid for the synthesis of eicosanoids.

Arachidonic Acid↗