Search PubMed⌕ Search

Biomedical subjects

J Arenas

Publications and source records attributed to J Arenas.

At least 19 recordsLinked to original sources

Molecular genetics of McArdle's disease.

This review highlights recent advances in our understanding of McArdle's disease, including the mechanisms involved in the regulation of the clinical phenotype. The latest molecular genetic studies have demonstrated the genetic heterogeneity of the disorder, with more than 65 mutations identified to date. There is not a specific treatment for McArdle's disease, but some nutritional treatments in combination with aerobic conditioning could improve the quality of life in most patients.

Glycogen Phosphorylase, Muscle Form↗

Can patients with McArdle's disease run?

Patients with McArdle's disease commonly adopt a sedentary lifestyle. This sedentary behaviour, however, usually worsens the limited exercise capacity of these patients. Although eccentric muscle work can be associated with rhabdomyolysis, supervised eccentric training with gradually increasing loads has important advantages compared with conventional concentric work, particularly for patients with a poor cardiorespiratory system. We report the beneficial effects (particularly, increased VO(2peak) (from 14.6 to 30.8 ml/kg/min) and increased gross muscle efficiency (from 13.8% to 17.2%)) induced by a supervised aerobic training programme of 7 months duration including 3-4 running sessions (< or =60 min/session) per week in a 38-year-old patient. These preliminary data suggest the potential therapeutic value of this type of exercise in these patients.

Adult↗

Mobilisation of mesenchymal cells into blood in response to skeletal muscle injury.

Mesenchymal cells recruited to damaged tissues must circulate through the bloodstream. The absolute numbers of circulating mesenchymal stem cells (cMSCs) in two different models of acute and chronic skeletal muscle injury were determined. cMSCs were present in significantly higher numbers in both models than in healthy controls. These results support the hypothesis that MSCs are mobilised into the bloodstream after skeletal muscle tissue damage. These two models (acute and chronic) would be of value in the search for molecular mediators of mobilisation of MSCs into the circulation.

Adult↗

Mitochondrial activity is modulated by TNFalpha and IL-1beta in normal human chondrocyte cells.

OBJECTIVE: Pro-inflammatory cytokines play an important role in osteoarthritis (OA). In osteoarthritic cartilage, chondrocytes exhibit an alteration in mitochondrial activity. This study analyzes the effect of tumor necrosis factor-alpha (TNFalpha) and interleukin-1beta (IL-1beta) on the mitochondrial activity of normal human chondrocytes. MATERIALS AND METHODS: Mitochondrial function was evaluated by analyzing the activities of respiratory chain enzyme complexes and citrate synthase, as well as by mitochondrial membrane potential (Deltapsim) and adenosine triphosphate (ATP) synthesis. Bcl-2 family mRNA expression and protein synthesis were analyzed by RNase protection assay (RPA) and Western-blot, respectively. Cell viability was analyzed by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) and apoptosis by 4', 6-diamidino-2-phenylindole dihydrochloride (DAPI) stain. Glycosaminoglycans were quantified in supernatant by a dimethyl-methylene blue binding assay. RESULTS: Compared to basal cells, stimulation with TNFalpha (10 ng/ml) and IL-1beta (5 ng/ml) for 48 h significantly decreased the activity of complex I (TNFalpha=35% and IL-1beta=35%) and the production of ATP (TNFalpha=18% and IL-1beta=19%). Both TNFalpha and IL-1beta caused a definitive time-dependent decrease in the red/green fluorescence ratio in chondrocytes, indicating depolarization of the mitochondria. Both cytokines induced mRNA expression and protein synthesis of the Bcl-2 family. Rotenone, an inhibitor of complex I, caused a significant reduction of the red/green ratio, but it did not reduce the viability of the chondrocytes. Rotenone also increased Bcl-2 mRNA expression and protein synthesis. Finally, rotenone as well as TNFalpha and IL-1beta, reduced the content of proteoglycans in the extracellular matrix of normal cartilage. CONCLUSION: These results show that both TNFalpha and IL-1beta regulate mitochondrial function in human articular chondrocytes. Furthermore, the inhibition of complex I by both cytokines could play a key role in cartilage degradation induced by TNFalpha and IL-1beta. These data could be important for understanding of the OA pathogenesis.

Adenosine Triphosphate↗

NARP-MILS syndrome caused by 8993 T>G mitochondrial DNA mutation: a clinical, genetic and neuropathological study.

The 8993 T>G mutation in mitochondrial DNA has been associated with variable syndromes of differing severity ranging from maternally inherited Leigh's syndrome (MILS) to neuropathy, ataxia, retinitis pigmentosa (NARP), depending on the mutation loads in affected patients. We report a kindred with several members in the same generation suffering NARP or Leigh's syndrome due to a 8993 T>G mutation. Post-mortem studies of the brain in one affected member clinically presenting with a neurological disorder intermediate between adult Leigh's syndrome and NARP showed symmetrical lesions of the basal ganglia and brainstem closely resembling those usually described in typical Leigh's syndrome. Analysis of mtDNA in different tissues showed a high proportion of mutant genome in brainstem, cerebral cortex, putamen, cerebellum and thalamus. These observations illustrate the continuum of clinical and neuropathological manifestations associated with the 8993 T>G mutation of the mtDNA.

Adenosine Triphosphatases↗

Preservation of the liver graft with Celsior solution.

INTRODUCTION: We studied the evolution of the liver graft with preservation in Celsior (CS) compared with University of Wisconsin solution (UW). MATERIAL AND METHODS: A randomized prospective clinical study in 80 liver transplants (OLTs) from May 2001 to October 2003, compared CS (group I; n = 40) and UW (group II; n = 40). The characteristics of the donors were homogeneous, with no significant differences in 15 variables. CS was perfused with 4 L through the aorta, 2 L through the portal vein, and 1 L, through the portal vein on the back table; and the UW, as 3 L, 2 L, and 1 L, respectively. All OLTs were performed using the piggyback technique. RESULTS: Group I experienced reperfusion syndrome (n = 2; 5.9%), primary graft nonfunction (n = 0); vascular complications (n = 0); biliary anastomosis stenosis (n = 8; 22.9%), intensive care unit (ICU) days (n = 4.1 +/- 1), death within 30 days (n = 1; 3.1%). The patient and graft survivals at 1, 3, 6, 12, and 24 months were 93.7%, 93.7%, 90.2%, 85.7%, 85.7%, and 94.3%, 88.5%, 85.2%, 78%, 78%, respectively. For group II; the reperfusion syndrome occured in 6 patients (17.6%); primary graft nonfunction (n = 0); vascular complications (n = 0), biliary anastomosis stenosis (n = 3; 8.6%), ICU days (n = 4.9 +/- 2.4) and death within 30 days (n = 1; 3.1%); The patient and graft survival at 1, 3, 6, 12, and 24 months were 96.9%, 93.5%, 89.8%, 79.8%, 79.8% and 94.3%, 88.3%, 84.9%, 75.5%, 66.1%, respectively. CONCLUSIONS: CS offers the similar safety to UW for preservation of liver grafts within these ischemia times.

Adenosine↗

Renal disease burden following liver transplantation.

UNLABELLED: Significant chronic kidney disease (CKD) occurs following orthotopic liver transplant (OLT). Since CKD is associated with increased cardiovascular events, mortality, and hepatic allograft dysfunction, early recognition of CKD and implementation of changes may improve the long-term outcome. The purpose of this study was to determine the burden of renal disease following OLT. PATIENTS AND METHODS: We retrospectively reviewed our OLT recipients from 1997 until 2004. We calculated glomerular filtration rates (GFR) using the Modification of Diet in Renal Disease study (MDRD) method. The GFRs were further subdivided into pre-MELD and post-MELD eras. RESULTS: During the study period, we performed 407 OLTs. We censored data from living donor liver transplants (n = 14), combined liver-kidney transplants (n = 12), and from patients whom we did not have complete data for 6 months after transplant (n = 40). Mean MELD score at the time of transplant was 18 +/- 7 (mean +/- standard deviation). The mean GFR at 6 months following OLT was 63.7 +/- 30.2 mL/min per 1.73 m(2). Only 14% (n = 47) of our patients had normal renal function at 6 months, while 78% (n = 266) of our patients had mild to moderate risk for renal failure. Eight percent (n = 28) had stage 4 or 5 CKD. There were no differences between the pre-MELD and post-MELD GFRs. CONCLUSIONS: The burden of renal disease is significant in our patient population at 6 months posttransplantation. It may be important to introduce CKD management as early as 6 months after transplant to impact the outcomes of OLT recipients.

Adult↗

Sonographic differences in venous return between piggyback versus caval interposition in adult liver transplantations.

UNLABELLED: The piggyback technique (PT) is being used more frequently than caval interposition (CI) in adult orthotopic liver transplants (OLT). It is unclear whether PT alters venous return compared with CI, therefore leading to postoperative complications. The aim of our study was to analyze our experience with PT and CI by comparing ultrasound results of hepatic vein flow on the first postoperative day. PATIENTS AND METHODS: This retrospective analysis of consecutive OLTs performed between 2002 and 2005 included data from a single blinded radiologist who reviewed all postoperative day 1 ultrasound examinations. The hepatic vein waveforms were scored as all phasic, all flat, or partially phasic/flat. RESULTS: During the study period, we performed, 465 OLT among which 270 had available ultrasound examinations. The etiologies of liver disease were similar between the PT and CI cohorts, hepatitis C and alcoholic liver disease accounted for more than 60%. Two hundred eight (77%) had undergone PT and 62 (23%) CI. Among the PT, 60% were phasic, 31.1% were partially phasic/flat, and 8% were flat. When a CI was performed, 56.5% were phasic, 35.5% were partially phasic/flat, and 8% were flat. CONCLUSIONS: There was no significant difference between PT and CI with regard to an effect on hepatic vein waveforms on the first operative day. Therefore, there do not appear to be early hemodynamic benefits of performing CI versus PT anastamoses of OLTs. Further studies may be needed to determine whether long-term sequelae follow the piggyback technique.

Adult↗

Influence of hepatitis C on renal function after liver transplantation.

Liver transplantation (OLT) is often complicated by renal failure. Hepatitis C (HCV) is said to be a risk factor for renal failure after OLT, but few studies have analyzed this directly. We evaluated all patients who received a liver transplant from 1995 through 2003. There were 147 patients infected with HCV and 202 not infected. Patients with HCV were further divided into 114 patients with benign HCV and 33 patients with severe HCV defined by bridging fibrosis or cirrhosis. The groups were evaluated for the development of renal insufficiency defined as a creatinine above 1.8 mg/dL on three consecutive occasions or renal failure as defined by the need for dialysis or renal transplant. The incidence of renal failure in patients with HCV was 10.2% and in patients without HCV was 3.5% (P = .004). Patients with severe HCV had an incidence of 12.1% vs 9.7% for patients with mild HCV. The linear trend in renal failure from non-HCV to mild HCV to severe HCV was significant (P = .012). The incidence of renal insufficiency was 23.4% in patients with HCV and 14.9% in patients without HCV (P = .080). The incidence was 32.3% in patients with severe HCV and 20.6% in patients with mild HCV. The trend in renal insufficiency across the three groups was mildly significant (P = .042). On multivariate analysis, HCV was a risk factor for renal failure with a relative risk of 2.58 (P = .045). The study suggests that HCV and the severity of recurrent HCV are risk factors for renal dysfunction after liver transplantation.

Creatinine↗

Does the C34T mutation in AMPD1 alter exercise capacity in the elderly?

Ageing does affect functional capacity through several changes at the peripheral muscle level that impair the muscles capacity to produce energy and generate force. The skeletal muscle-specific isoform of AMP deaminase (AMPD) plays an important regulatory role in muscle metabolism and in determining energy charge. Since nearly 20 % of the general Caucasian population is heterozygous (CT) for the most common C34T mutation of the gene (AMPD1) encoding for this enzyme, it would be worthwhile to study if such a condition further increases the effects of ageing. Twenty-one women (61 - 80 yrs) served as subjects, and depending on the results of previous genotyping, were assigned to a group with the C34T mutation (heterozygous; n=4; mean+/-SEM age: 71+/-1 yrs) or with no mutation (n=17; 68+/-1 yrs). Several indices of maximal (peak oxygen uptake [V.O (2 peak)], peak power output) and submaximal endurance performance (ventilatory threshold, mechanical efficiency) and functional tests (one-mile walk test and a specific test of lower-body functional performance [sit-stand test]) were compared between the two groups. No significant differences were found in exercise capacity between both groups, e. g. V.O (2 peak) of 19.1+/-1.0 vs. 20.1+/-1.9 ml . kg (-1) . min (-1), V.O (2) at the VT of 11.9+/-0.6 vs. 12.9+/-1.0 ml . kg (-1) . min (-1), or time to complete the one-mile walk test (951+/-18 s vs. 962+/-61 s) and sit-stand test (9.9+/-0.2 vs. 9.2+/-0.2) (no mutation vs. C34T mutation, respectively). Although more research is necessary, it seems that the C34T mutation of the AMPD1, at least in heterozygous individuals, does not affect functional capacity in the elderly.

AMP Deaminase↗

C34T mutation of the AMPD1 gene in an elite white runner.

The case is reported of an elite, male, white endurance runner (28 years of age), who is one of the best non-African runners in the world despite carrying the C34T mutation in the gene (AMPD1) that encodes the skeletal muscle specific isoform of AMP deaminase, an enzyme that plays an important role in muscle metabolism. The frequency of the mutant allele in sedentary white people is 8-11%. Previous research has shown that this mutation, at least in homozygotes, can impair the exercise capacity of untrained people and their trainability. The maximum oxygen uptake of the study subject was exceptionally high (83.6 ml/kg/min), whereas his ammonia and lactate concentrations at high submaximal running speeds were lower than those of other world class runners who are not carriers of the mutation. The partial metabolic deficiency of the study subject is possibly compensated for by his exceptionally favourable anthropometric characteristics (body mass index 18.2 kg/m2).

AMP Deaminase↗

Exercise capacity in a 78 year old patient with McArdle's disease: it is never too late to start exercising.

The case is reported of a 78 year old man with McArdle's disease and a history of treated coronary heart disease. Despite the pre-exercise administration of sucrose allowing the patient to exercise with normal physiological responses, and without typical McArdle's symptoms or biochemical evidence of muscle damage, his exercise capacity was very low (V(O2)peak = 10.7 ml/min/kg), probably attributable to his lifetime of sedentary living. The data suggest that, with pre-exercise sucrose administration, such patients may be candidates for systematic reconditioning, which may improve functional capacity and quality of life.

Aged↗

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗

Variable presentation of the clinical phenotype of McArdle's disease in a kindred harbouring a novel compound genotype in the muscle glycogen phosphorylase gene.

We report a Spanish family with muscle glycogen phosphorylase (PYGM) deficiency (McArdle's disease) harbouring a novel compound genotype (A659D/L586P). Four individuals who had the same genotype for PYGM, showed a wide variability in the presentation of the clinical phenotype, including one patient with a restrictive respiratory pattern, which is unusual in McArdle's disease. Moreover, these patients were studied for the insertion/deletion (I/D) trait in the angiotensin converting enzyme (ACE) which has been suggested to be a strong modulator of severity in McArdle's disease. Our results indicate no association of the I/D ACE trait in this family, suggesting that other factors would be more relevant in determining the severity of the clinical presentation.

Aged↗

Transjugular intrahepatic portosystemic shunts for refractory ascites after liver transplantation.

PURPOSE: To study the efficacy of transjugular intrahepatic portosystemic shunts (TIPS) in the management of refractory ascites after liver transplantation. PATIENTS AND METHODS: Between January 1995 and December 2003, 309 primary adult liver transplants were performed. Refractory ascites was defined as active interventions (salt restriction, diuretic use, repeated paracentesis) needed beyond 30 days after transplantation. These patients were managed with TIPS placement. RESULTS: Eight TIPS were placed in 8 patients at a mean of 11.5 months after transplantation (range, 2-36 months). There were 5 males and 3 females, age 54 +/- 8.2 years. Hepatitis C was the primary diagnosis in 7 patients and primary biliary cirrhosis in 1. Indications for TIPS included refractory ascites (8), associated variceal bleeding (2), and various degrees of hepatic vein outflow stenosis (3). Seven patients had resolution of ascites and associated findings of portal hypertension, and 1 patient with persistent ascites had severe hepatic vein outflow stenosis and associated hepatitis C in the allograft. Two patients required retransplantation for recurrent hepatitis C. There were 3 deaths: liver failure (1), organ failure after retransplantation (1), and lung cancer 5 months after TIPS (1). Currently, 5 patients are alive without clinical evidence of ascites 9, 13, 15, 24, and 70 months after TIPS. CONCLUSIONS: The TIPS device can be used safely and effectively to control refractory ascites after liver transplantation. In the setting of organ dysfunction, these patients should be considered sooner for retransplantation.

Adult↗

Importance of early adequate exposure to cyclosporine in renal transplant outcome: study of 1-year creatinine.

INTRODUCTION: One-year serum creatinine (SCr) level has been used as a surrogate marker for graft survival in kidney transplantation. We evaluated the importance of different factors on this parameter, emphasizing the importance of adequate exposure to Cyclosporine (CyA). METHODS: Ninety-six consecutive renal transplant recipients who underwent transplantation between 1996 and 2002 were treated with CyA, steroids, and azathioprine. Univariate and multivariate regression analyses were performed for 1-year SCr, acute rejection episodes (ARE), and duration of delayed graft function (DGF). We considered adequate CyA levels within 1 week to be >250 ng/mL trough levels (38%) or 3 hour postdose level (C3) >1100 ng/mL (62%). RESULTS: Mean 1-year SCr was 1.52 +/- 0.5, ARE rate was 27%, and DGF rate was 31%. Overall, 53% of patients achieved adequate exposure to CyA at 1 week (68% on those monitored by C3). Univariate analysis identified female recipient gender, decreasing donor age, absence of ARE, and decreased DGF duration to yield lower 1-year SCr (P < .05). On multivariate analysis for donor age (lower), ARE rate, and duration of DGF (shorter) were the only factors considered to be significant for a lower 1-year SCr level. Multivariate analysis for ARE showed that adequate CyA exposure and lower HLA mismatch decreased ARE, whereas the ability to achieve adequate exposure to CyA and shorter cold ischemia time (CIT) correlated with a reduced incidence of DGF. CONCLUSIONS: One-year SCr level is affected primarily by the incidence of ARE, by donor age, and by duration of DGF. Adequate CyA exposure is related to lower ARE; however, its relation to DGF may be influenced by the reluctance to increase exposure on patients with a nonfunctioning graft.

Creatinine↗

Benefits of early biopsy on the outcome of kidney transplantation.

INTRODUCTION: Delayed graft function has been associated with worse long-term kidney allograft survival. Adequate diagnosis of the etiology of dysfunction is crucial, often requiring routine early biopsies. The aim of this article was to report the results and safety of early kidney allograft biopsies and how they influenced its management. METHOD: Between September 1994 and July 2004, 134 renal transplant recipients were prescribed cyclosporine (CsA; Neoral, Novartis, Chile), steroids, and a third agent (azathioprine in 92% of the graft recipients). Thirty-four patients (26%) had a kidney biopsy performed within the first week because of allograft dysfunction. RESULTS: The main diagnosis was acute tubular necrosis (ATN) in 22 patients (65%), whereas 6 (18%) were diagnosed with an acute rejection episode (ARE), allowing prompt initiation of therapy with reversal of rejection in 4 of them. Two patients (6%) showed signs of thrombotic microangiopathy (TMA) induced by CsA, which subsided following a switch from CsA to tacrolimus (Prograf Pharmainvesti, Chile). In 2 patients, the biopsy specimen showed signs of CsA nephrotoxicity that reverted following dose reduction. Finally, in 2 patients, the biopsy specimen showed chronic nephropathy of donor origin, which had not been previously recognized, resulting in graft loss. There was only one major complication related to the biopsy, intraperitoneal bleeding that required surgical treatment. CONCLUSIONS: Early allograft biopsy is safe and, in a significant number of cases (30%), it detects important allograft pathology (ARE, TMA, and drug toxicity), which when adequately and promptly treated may rescue the graft.

Acute Disease↗

Design and application of compliant mechanisms for surgical tools.

This paper introduces the benefits of exploiting elasticity in the engineering design of surgical tools, in general, and of minimally invasive procedures, in particular. Compliant mechanisms are jointless mechanisms that rely on elastic deformation to transmit forces and motion. The lack of traditional joints in these single-piece flexible structures offers many benefits, including the absence of wear debris, pinch points, crevices, and lubrication. Such systems are particularly amenable to embedded sensing for haptic feedback and embedded actuation with active-material actuators. The paper provides an overview of design synthesis methods developed at the Compliant Systems Design Laboratory and focuses specifically on surgical applications. Compliant systems have potential to integrate. well within the constraints of laparoscopic procedures and telerobotic surgery. A load-path representation is used within a genetic algorithm to solve two gripper example problems. In addition, the paper illustrates the design and construction of an organ (kidney) manipulator for use in minimally invasive procedures.

Computer Simulation↗