Search PubMed⌕ Search

Biomedical subjects

J Andersen

Publications and source records attributed to J Andersen.

At least 325 records · Page 18Linked to original sources
PubMed1983

Bone marrow necrosis. Report of a case and a brief review of the literature.

Bone marrow necrosis (BMN) is a rare finding in specimens from living patients. It is most commonly found in patients with neoplastic disorders, severe infections and sickle cell disease. We present a patient with Hodgkin's disease who developed extensive BMN 11 months before death. A concise review of the literature is also presented.

Bone Marrow Diseases↗
PubMed1982

Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.

Animals↗
PubMed1982

Estrogen receptor content and ploidy of human mammary carcinoma.

In 46 cases of invasive ductal mammary carcinoma the relationship between estrogen receptor (ER) content and ploidy was investigated. Seventy-one percent of the diploid tumors were ER+ against 40% ER+ tumors in the nondiploid group. Forty percent of the ER+ cases had nondiploid tumors and in several of these more than one tumor cell population could be demonstrated. The results support the hypothesis that multiclonal or mosaic composition of the tumor may explain why 30-45% of the patients with apparently ER+ tumors do not respond to endocrine therapy.

Breast Neoplasms↗
PubMed1982

On the phylogeny of Phycomyces blakesleeanus. Nucleotide sequence of 5 S ribosomal RNA.

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RNA sequence has invariant nucleotide positions characteristic of other eukaryotic 5 S RNAs and fits currently proposed secondary structural models. The Phycomyces of 5 S RNA shows relatively low overall sequence homology to the higher fungal (Ascomycetes) 5 S RNAs (56-60%) but shows higher sequence homology to those 5 S RNAs from Tetrahymena thermophila (68%), human KB cells (67%), and Spinacia oleracea (62%). A comparison of individual segments of the RNA also shows that the structure of Phycomyces 5 S RNA has several major differences from structures common to the higher fungi. Positions 2-14 are homologous with those of metazoan and some protozoan 5 S RNAs. At positions 30-45, the RNA sequence is closer to metazoan 5 S RNAs than to the Neurospora of Aspergillus 5 S RNAs. The Phycomyces 5 S RNA shares similar sequences with both Aspergillus and Tetrahymena 5 S RNAs at positions 79-99. Several other important homologies in primary and proposed secondary structures also have been observed in comparing Phycomyces 5 S RNA with animal and plant 5 S RNAs. We conclude that Phycomyces may not be as closely related phylogenetically to the Ascomycetes as previously thought.

Base Sequence↗
PubMed1982

Oestrogen receptors in human breast cancer. Problems of correlation with histopathological features.

Histopathological factors which might explain inconsistency in published data attempting to correlate oestrogen receptor content (ER) and pathological features in primary breast tumours have been investigated in 194 cases. It was found, that unequal assessment of tumour type and of histological grading between observers is one important factor. In terms of grading, however, heterogeneity of growth pattern within the same tumour seems to be of greater significance. No significant correlation was found between histological type of tumour and ER content. However, a trend towards a correlation between the extent of tubule formation (as an indication of differentiation) and ER content was observed.

Biopsy↗
PubMed1982

Serum concentrations of cis(Z)-flupentixol and prolactin in chronic schizophrenic patients treated with flupentixol and cis(Z)-flupentixol decanoate.

Nine chronic schizophrenic patients selected from three hospital departments were treated with flupentixol (orally and IV) and cis(Z)-flupentixol decanoate in Viscoleo (IM) in a three-phase pharmacokinetic study. Oral administration (single and repeated dosage) showed a relatively slow absorption with maximum serum concentration around 4 h after administration. Intravenous injection indicated multicompartment kinetics for cis(Z)-flupentixol. The biological half-lives calculated after the different doses were the same, indicating that the pharmacokinetics of cis(Z)-flupentixol does not differ between single and repeated administration and does not change when moderately higher doses are given. The bioavailability of orally administered cis(Z)-flupentixol was calculated to be about 40% with IV injection as reference. After IM administration maximum serum concentration was seen between 4 and 10 days in most patients. Calculation of a disappearance half-life gave very variable results, indicating that the release of the drug from the oil depot is not a monoexponential process. The intramuscular depot had a much lower bioavailability than IV injection, which means that steady state has not been obtained after 8 weeks of depot treatment. Serum prolactin concentrations were elevated during neuroleptic treatment, but no correlation was found between prolactin concentrations and the serum concentrations of cis(Z)-flupentixol. A correlation between the changes in clinical ratings and concentrations of cis(Z)-flupentixol or prolactin was not found.

Administration, Oral↗
PubMed1982

Short-term culture of human breast cancer: in vitro effects of hormones related to patient response.

Breast-cancer tissue from 60 patients was tested for oestrogen and testosterone sensitivity in vitro by measuring [3H]-dT incorporation in tissue fragments at various times during 48h culture. Hormone sensitivity in test culture was determined as an increase or decrease in dT uptake. In vitro cultures of breast cancer tissue demonstrate that some tumours are hormone-sensitive and others hormone-insensitive, but it cannot be predicted whether cell proliferation is stimulated or inhibited by hormone treatment. The data were related to the clinical stage of the patients, menopausal status, and the degree of anaplasia of the tumours tested. No correlation was observed between these parameters and in vitro hormonal sensitivity. However, when related to the response of patients to various kinds of hormonal treatment, a significant positive correlation was obtained.

Breast Neoplasms↗
PubMed1982

IgD-Fc receptors on normal and neoplastic human B lymphocytes.

Lymphocytes from normal peripheral blood and human lymphoid tumours were studied for AggIgD binding. In normal blood, 2.0-3.7% of lymphoid cells bound to IgD aggregates. Using double labelling and, enrichment and depletion experiments, a subset of normal B but not T lymphocytes exhibited IgD binding. In blocking experiments, AggIgD binding was shown to be specific and Fc dependent. Likewise, B but not T derived neoplastic lymphoid clones expressed Fc delta receptors. Fc delta receptors were exclusively present on neoplastic clones that also expressed SmIgD. Neoplastic lymphoid cells expressing SmIgM alone did not express Fc delta. The chronic lymphocytic leukaemia cell which typically bore membrane SmIgM and SmIgD expressed multiple FcR with specificities for IgM, IgD and IgG. In sequential surface redistribution experiments, Fc delta and Fc mu receptor-ligand binding produced the 'co-capping' phenomenon which was bidirectional in nature suggesting membrane association.

B-Lymphocytes↗
PubMed1981

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.

Animals↗
PubMed1981

The nucleotide sequence of spinach cytoplasmic 5 S ribosomal RNA.

The nucleotide sequence of the cytoplasmic 5 S ribosomal RNA from Spinacia oleracea has been determined. A secondary structural model possessing four base-paired regions can be constructed from the primary structure. This RNA shows 90 to 93% nucleotide sequence homology with other higher plant cytoplasmic 5 S RNAs and 73% homology with that of the lower eukaryote Chlorella. The spinach 5 S RNA has the nucleotide sequence identical with that of Chlorella in two important single-stranded regions, the sequence C10 AUACC and the dodecanucleotide sequence at positions 33 to 44. A nucleotide sequence similar or identical with C10 AUACC is found in most other eukaryotic 5 S RNAs, including the 5 S RNA from human KB cells. In addition, a single-stranded loop of 12 residues corresponding to positions 33 to 44 in the spinach 5 S RNA sequence may be a general feature of eukaryotic cytoplasmic 5 S RNAs, while prokaryotic 5 S RNAs have a 13-member loop for the corresponding residues. Several other important homologies in primary and secondary structure have also been observed in comparing spinach 5 S RNA to other 5 S RNAs.

Base Sequence↗
PubMed1981

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

Base Sequence↗