Search PubMed⌕ Search

Biomedical subjects

J Abelson

Publications and source records attributed to J Abelson.

At least 145 records · Page 8Linked to original sources
PubMed1978

Sequence of a RNA templated by the 3'-OH RNA terminus of defective interfering particles of vesicular stomatitis virus.

We have sequenced the endogenous RNA polymerase product produced by disrupted purified virions of vesicular stomatitis virus defective interfering particles by using the newer one-dimensional rapid gel sequencing techniques and confirming this with a modified two-dimensional gel vectoring technique. The sequence of this 46-nucleotide RNA is: 5'(pp)pACGAAGACCACAAAACCA-GAUAAAAAAUAAAAACCACAAGAGGG(U)COH3'. We infer that this sequence is identical to the sequence at the 5' end of infectious vesicular stomatitis virus RNA and is complementary to the sequence of the 3'-OH terminus of this defective interfering particle genome RNA.

Base Sequence↗
PubMed1978

The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4.

The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species alpha) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACA G. The nucleotide sequence was determined primarily by nearest-neighbor analysis of RNA synthesized in vitro using [alpha-32P]nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labeled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbor data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules.

Anticodon↗
PubMed1978

Cloning of Beneckea genes in Escherichia coli.

Genes from Beneckea harveyi, a luminescent marine bacterium, were cloned in Escherichia coli. This was done by producing randomly sheared fragments of Beneckea DNA and inserting them into the EcoRI site of plasmid pMB9 by the adenine-thymine joining procedure. The hybrid plasmids were used to transform E. coli C600 SF8. Among the transformants selected for tetracycline resistance, one clone that appeared to complement a leucine tb mutation was identified. The transformants were screened for the presence of Beneckea 5S genes. Four of these clones were analyzed in detail by hybridization with 16S, 23S, and 4S Beneckea RNA. The observations suggest that the ribosomal genes in Beneckea are linked, but are present in a different order than those in E. coli.

DNA, Bacterial↗
PubMed1977

Nucleotide sequence of an arginine transfer ribonucleic acid from bacteriophage T4.

The nucleotide sequence of a phage T4-coded low molecular weight RNA, previously designated polyacrylamide gel band epsilon, has been determined. This RNA can be arranged in the cloverleaf configuration common to tRNAs, with an anticodon sequence, U-C-U, which corresponds to the arginine-specific codons A-G-A and A-G-G; it is therefore assumed to be an arginine tRNA. The complete nucleotide sequence of this RNA species is: pG-U-C-C-C-G-C-U-G-G-U-G-U-A-A-U-Gm2'-G-A-D-A-G-C-A-U-A-C-G-A-U-C-C-U-U-C-U-A-A-G-psi-U-U-G-C-G-G-U-C-C-U-G-G-T-psi-C-G-A-U-C-C-C-A-G-G-G-C-G-G-G-A-U-A-C-C-AOH. The nucleotide sequence was determined by analysis of RNA, uniformly labeled in vivo, according to the conventional techniques. In addition, RNA synthesized in vitro in the presence of alpha-32P-labeled nucleoside triphosphates was analyzed through the use of nearest neighbor sequencing techniques. Although a unique sequence could not be determined by this latter analysis, restrictions on the sequence imposed by nearest neighbor data and secondary structure common to tRNA molecules allowed prediction of the correct nucleotide sequence.

Arginine↗
PubMed1977

Cloning of yeast transfer RNA genes in Escherichia coli.

Four thousand Escherichia coli clones containing yeast DNA inserted into the plasmid pBR313 have been isolated. Of these, 175 clones were identified as carrying yeast transfer RNA genes. The initial analysis of the inserted transfer RNA genes via the colony hybridization technique with individual radioactive transfer RNA species is reported. The data indicate that yeast transfer RNA genes are not highly clustered, although some clustering exists. In addition, it was observed that the reiteration number of different transfer RNA genes may vary extensively.

Chromosome Mapping↗
PubMed1976

In vitro construction of bacteriophage lambda and plasmid DNA molecules containing DNA fragments from bacteriophage T4.

Restriction endonucleases EcoRI and HindIII generated fragments of T4 cytosine-containing DNA were inserted into bacteriophage vector lambdagtSuIII and plasmid vectors pMB9 and pBR313. Resulting clones were screened for hybridization with 32P labeled T4 tRNA. Recombinant bacteriophages and plasmids were isolated which contained a T4 fragment coding for T4 RNA species 1 and 2 and T4 tRNA Arg. Selected lambda-T4 hybrid bacteriophages were grown to high titer and their DNA analyzed by gel electrophoresis.

Coliphages↗
PubMed1976

Cleavage of T4 species I ribonucleic acid by Escherichia coli ribonuclease III.

T4 Species I RNA, a molecule 140 nucleotides in length with some structural features very much like a tRNA, is specifically cleaved by an enzymatic activity in Escherichia coli extracts to give three segments with 19, 48 and 73 nucleotides. We report the purification and characterization of the E. coli RNase which cleaves two 3' phosphodiester bonds of T4 Species I RNA. This reaction has many properties in common with those catalyzed by E. coli RNase III, although the optimal salt conditions for T4 Species I RNA cleavage differ significantly from those for other RNase III-catalyzed reactions. The reaction is not catalyzed by extracts from an E. coli strain lacking RNase III activity. Furthermore, T4 Species I RNA is cleaved by highly purified E. coli RNase III to yield the same three specific fragments. We conclude that this specific cleavage is due to the action of RNase III, and that the requirement for lower ionic strength may reveal further important properties about this RNA processing enzyme.

Cations, Divalent↗
PubMed1975

Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid.

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.

Alkaline Phosphatase↗
PubMed1975

Nucleotide sequence determination of bacteriophage T2 and T6 species I ribonucleic acids.

The nucleotide sequences of species I RNA coded for by bacteriophages T2 and T6 have been analyzed using 32-P-labeled material from T2 and T6-infected cultures of Escherichia coli. The T1 and pancreatic ribonuclease digestion products were partially analyzed and the results were compared with nucleotide sequences from T4 species I RNA to obtain a minimum estimate of the number of nucleotide sequence differences among the three species I RNAs. Analysis of fragments obtained by digestion with epsilon-carboxymethyl-lysine-41-pancreatic ribonuclease and with E. coli Q13 S30 crude extract was also performed to provide some additional confirmation for the nucleotide sequences that were derived for the T2 and T6 species I RNAs. T2 species I RNA was found to be different at three positions in the nucleotide sequence, and unlike T4 species I RNA, contained in addition the modified nucleotide, psi, in a region where the proposed secondary structure is identical to the TpsiC-loop of a tRNA. T6 species I RNA was found to contain nucleotide differences from the T4 species I RNA sequence at four positions. The U at position 119 in the sequence appears to be modified to psi only to a small extent. While a biological function for species I RNA is unknown, the fact that there is over 97% homology in the sequences suggests strong evolutionary pressures to retain the nucleotide sequence in the T-even genomes.

Base Sequence↗
PubMed1975

Genetic regulation: the Lac control region.

The nucleotide sequence of the lac promoter-operator region has been determined. The 122 base pairs comprising this region include the recognition sites for RNA polymerase, the positive regulatory protein, CAP, and the negative regulatory protein, the repressor. Identification of mutant variants of the sequence combined with the in vitro biochemical studies of others has allowed us to tentatively identify the recognition site for each of these proteins, and to suggest how CAP might act at a distance to affect the interaction of RNA polymerase with the promoter.

Base Sequence↗
PubMed1975

Characterization of the inhomogeneous DNA in virions of bacteriophage Mu by DNA reannealing kinetics.

The DNA of bacteriophage Mu has been studied to characterize a region of inhomogeneous sequence that occurs at one end of the molecule. The kinetics of reassocation of tracer amounts of labeled host DNA in the presence of Mu DNA show that Mu DNA contains a complete selection of host sequences. These host sequences are shown to be covalently attached to phage-specific sequences and are present at a concentration that accounts for the inhomogeneity observed in the electron microscope. The significance and possible function of the host DNA attachment is discussed.

Base Sequence↗
PubMed1974

Nucleotide sequence determination of bacteriophage T4 glycine transfer ribonucleic acid.

The nucleotide sequence of a T4 tRNA with an anticodon for glycine has been determined using (32)P-labeled material from T4-infected cultures of Escherichiacoli. The sequence is: pGCGGAUAUCGUAUAAUGmGDAUUACCUCAGACUUCCAApsiCUGAUGAUGUGAGTpsiCGAUUCUCAUUAUCCGCUCCA-OH. The 74 nucleotide sequence can be arranged in the classic cloverleaf pattern for tRNAs. The anticodon of T4 tRNA(Gly) is UCC with a possible modification of the U. The tRNA molecule would thus be expected to recognize the glycine codons GGG and GGA. Comparative analysis of tRNAs(Gly) from T2 and T6 indicate that their sequences are identical with that from T4.

Anticodon↗