Search PubMedSearch

Biomedical subjects

I Tinoco

Publications and source records attributed to I Tinoco.

At least 19 recordsLinked to original sources

A base-triple structural domain in RNA.

An oligonucleotide modeled on a proposed base-triple domain of the Tetrahymena group I intron has been characterized by NMR. The oligonucleotide contains two double-helix regions with adjacent single-stranded nucleotides. The NMR data show that the two helices stack coaxially, although the rotation between the two helices is approximately twice as large as the rotation between normal base pairs. The rotation between the two helices allows the single-stranded nucleotides to form U.U.G and A.G.C base triples in the minor groove. The A.G.C base triple contains a hydrogen bond between the adenine N1 and a 2'-hydroxyl in the minor groove of the G.C pair. A similar hydrogen bond between an adenine and a 2'-hydroxyl in transfer RNA suggests that this could be a recurring tertiary interaction in RNA.

Animals

Thermodynamic parameters for loop formation in RNA and DNA hairpin tetraloops.

We determined the melting temperatures (Tm) and thermodynamic parameters of 15 RNA and 19 DNA hairpins at 1 M NaCl, 0.01 M sodium phosphate, 0.1 mM EDTA, at pH 7. All these hairpins have loops of four bases, the most common loop size in 16S and 23S ribosomal RNAs. The RNA hairpins varied in loop sequence, loop-closing base pair (A.U, C.G, or G.C), base sequence of the stem, and stem size (four or five base pairs). The DNA hairpins varied in loop sequence, loop-closing base pair (C.G, or G.C), and base sequence of the four base-pair stem. Thermodynamic properties of a hairpin may be represented by nearest-neighbor interactions of the stem plus contributions from the loop. Thus, we obtained thermodynamic parameters for the formation of RNA and DNA tetraloops. For the tetraloops we studied, a free energy of loop formation (at 37 degrees C) of about +3 kcal/mol is most common for either RNA or DNA. There are extra stable loops with delta G degrees 37 near +1 kcal/mol, but the sequences are not necessarily the same for RNA and DNA. The closing base pair is also important; changing from C.G to G.C lowered the stability of several tetraloops in both RNA and DNA. These values will be useful in predicting RNA and DNA secondary structures.

Base Sequence

Poly(rA) binds poly(rG).poly(rC) to form a triple helix.

Poly(rA) binds poly(rG).poly(rC) to form a triple helix. Evidence for this structure includes ultraviolet absorbance mixing curves and melting curves, and circular dichroism spectroscopy. The formation of the triple helix depends on the length of the poly(rC) strand. Triple helix forms when the average length is around 100 nucleotides but does not form when the average length is about 500 nucleotides.

Circular Dichroism

A thermodynamic study of unusually stable RNA and DNA hairpins.

About 70% of the RNA tetra-loop sequences identified in ribosomal RNAs from different organisms fall into either (UNCG) or (GNRA) families (where N = A, C, G, or U; and R = A or G). RNA hairpins with these loop sequences form unusually stable tetra-loop structures. We have studied the RNA hairpin GGAC(UUCG)GUCC and several sequence variants to determine the effect of changing the loop sequence and the loop-closing base pair on the thermodynamic stability of (UNCG) tetra-loops. The hairpin GGAG(CUUG)CUCC with the conserved loop G(CUUG)C was also unusually stable. We have determined melting temperatures (Tm), and obtained thermodynamic parameters for DNA hairpins with sequences analogous to stable RNA hairpins with (UNCG), C(GNRA)G, C(GAUA)G, and G(CUUG)C loops. DNA hairpins with (TTCG), (dUdUCG), and related sequences in the loop, unlike their RNA counterparts, did not form unusually stable hairpins. However, DNA hairpins with the consensus loop sequence C(GNRA)G were very stable compared to hairpins with C(TTTT)G or C(AAAA)G loops. The C(GATA)G and G(CTTG)C loops were also extra stable. The relative stabilities of the unusually stable DNA hairpins are similar to those observed for their RNA analogs.

Base Sequence

Crystal structure of an RNA double helix incorporating a track of non-Watson-Crick base pairs.

The crystal structure of the RNA dodecamer duplex (r-GGACUUCGGUCC)2 has been determined. The dodecamers stack end-to-end in the crystal, simulating infinite A-form helices with only a break in the phosphodiester chain. These infinite helices are held together in the crystal by hydrogen bonding between ribose hydroxyl groups and a variety of donors and acceptors. The four noncomplementary nucleotides in the middle of the sequence did not form an internal loop, but rather a highly regular double-helix incorporating the non-Watson-Crick base pairs, G.U and U.C. This is the first direct observation of a U.C (or T.C) base pair in a crystal structure. The U.C pairs each form only a single base-base hydrogen bond, but are stabilized by a water molecule which bridges between the ring nitrogens and by four waters in the major groove which link the bases and phosphates. The lack of distortion introduced in the double helix by the U.C mismatch may explain its low efficiency of repair in DNA. The G.U wobble pair is also stabilized by a minor-groove water which bridges between the unpaired guanine amino and the ribose hydroxyl of the uracil. This structure emphasizes the importance of specific hydrogen bonding between not only the nucleotide bases, but also the ribose hydroxyls, phosphate oxygens and tightly bound waters in stabilization of the intramolecular and intermolecular structures of double helical RNA.

Base Sequence

A proton NMR study of a DNA dumb-bell structure with hairpin loops of only two nucleotides: d(CACGTGTGTGCGTGCA).

One- and two-dimensional nuclear magnetic resonance (NMR) experiments were used to study the conformation of the DNA hexadecanucleotide d(CACGTGTGTGCGTGCA) in aqueous solution. NMR spectra were recorded for the compound in D2O and in H2O/D2O (90/10) over the temperature range 1 degree C-60 degrees C. Assignments of imino proton resonances and of non-exchangeable proton resonances (except for some H4', H5' and H5" resonances) are given. The 1H-NMR spectra indicate that below about 20 degrees C, the compound exists as a single monomolecular species. Between 20 degrees C and 55 degrees C the oligonucleotide occurs as a mixture of structures in fast exchange on the NMR time scale, except for the temperature region 30 degrees - 34 degrees C, where substantial line broadening indicates intermediate exchange; above 60 degrees C the single strand predominates. The imino proton spectra, chemical shift values, and scalar coupling and NOE data reveal that the monomeric form, which is exclusively present below 20 degrees C, consists of a structure with a B-DNA double helix region of six base pairs, both ends of which are closed by hairpin loops of only two nucleotides, giving the molecule a dumbbell-like structure: [sequence: see text].

Base Sequence

Structure of an unusually stable RNA hairpin.

The structure of a very common RNA hairpin, 5'GGAC(UUCG)GUCC, has been determined in solution by NMR spectroscopy. The loop sequence, UUCG, occurs exceptionally often in ribosomal and other RNAs, and may serve as a nucleation site for RNA folding and as a protein recognition site. Reverse transcriptase cannot read through this loop, although it normally transcribes RNA secondary structure motifs. A hairpin with that loop displays unusually high thermodynamic stability; its stability decreases when conserved nucleotides are mutated. The three-dimensional structure for the hairpin was derived from interproton distances and scalar coupling constants determined by NMR using distance geometry, followed by restrained energy minimization. The structure was well-defined despite the conservative use of interproton distances, by constraining the backbone conformation by means of scalar coupling measurements. A mismatch G.U base pair, with syn-guanosine, closes the stem. This hairpin has a loop of only two nucleotides; both adopt C2'-endo sugar pucker. A sharp turn in the phosphodiester backbone is stabilized by a specific cytosine-phosphate contact, probably a hydrogen bond, and by stacking of the cytosine nucleotide on the G.U base pair. The structural features of the loop can explain the unusual thermodynamic stability of this hairpin and its sensitivity to mutations of loop nucleotides.

Base Sequence

Solution structure of an unusually stable RNA hairpin, 5'GGAC(UUCG)GUCC.

Hairpin loops are important structural elements of RNA, helping to define the three-dimensional structure of large RNAs and providing potential nucleation sites for RNA folding and interaction with other nucleic acids and proteins. Little, however, is known about the conformation of RNA hairpins, most of what we know coming from transfer RNA crystal structures and from studies of DNA hairpins. We report here the determination of the structure of a very stable and common RNA hairpin, 5'GGAC(UUCG)GUCC (loop nucleotides in parenthesis), by NMR spectroscopy. The sequence C(UUCG)G occurs very often in RNA and may be a nucleation site for RNA folding and a protein-binding site. A high-resolution structure for the hairpin was derived from interproton distances and scalar coupling constants determined by NMR. The loop is stabilized by a G.U base pair, with guanine in the syn conformation, a cytosine-phosphate contact and extensive base stacking. These findings and other structural features of the loop can explain the unusual stability of the hairpin and suggest why reverse transcriptase cannot read through the loop, although it can transcribe through other kinds of RNA secondary structure.

Base Composition

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

Base Sequence

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.

Base Sequence

Solution conformation of an RNA hairpin loop.

The hairpin conformation adopted by the RNA sequence 5'GCGAUUUCUGACCGCC3' has been studied by one- and two-dimensional NMR spectroscopy. Exchangeable imino spectra in 60 mM Na+ indicate that the hairpin has a stem of six base pairs (indicated by boldface type) and a loop of three nucleotides. NOESY spectra of nonexchangeable protons confirm the formation of the stem region. The duplex has an A-conformation and contains an A.C apposition; a G.U base pair closes the loop region. The stem nucleotides have C3'-endo sugar conformations, as expected of an A-form duplex, whereas the three loop nucleotides adopt C2'-endo sugar puckers. Stacking within the loop, C8 upon the sugar of U7, stabilizes the structure. The pH dependence of both the exchangeable and nonexchangeable NMR spectra is consistent with the formation of an A+.C base pair, protonated at the N1 position of adenine. The stability of the hairpin was probed by using absorbance melting curves. The hairpin structure with the A+.C base pair is about +2 kcal/mol less stable in free energy at 37 degrees C than the hairpin formed with an A.U pair replacing the A+.C pair.

Base Sequence

Z-RNA: the solution NMR structure of r(CGCGCG).

Left-handed double-helical Z-RNA has been studied using the ribohexanucleotide pentaphosphate r(CpGpCpGpCpG). One-dimensional and two-dimensional proton nmr experiments were used to probe the structural details of the left-handed helix in concentrated sodium perchlorate solution. In 1M NaClO4 the RNA adopts the normal A-form double helix, and in 6M NaClO4 it is nearly all in the Z form. In 4M NaClO4 it exists as nearly equal parts of A form and Z form. Resonances corresponding to both A and Z form appear in the nmr spectrum, indicating that the duplex exchanges slowly between forms. Spin-spin coupling constants between protons in the ribose rings were used to determine the sugar-pucker conformations of the individual nucleotides. Quantitative nuclear Overhauser experiments were used to determine proton-proton distances within the nucleoside, and from these distances values for the glycosidic torsion angle were determined. The results show that the cytidines adopt C2'-endo sugar puckers (S type) with pseudo-rotation phase values (P) of approximately 165 degrees. The bases are in the anti conformation, with chi values of approximately -140 degrees. The internal guanosines adopt C3'-endo sugar puckers (N type) with P approximately 18 degrees, while the 3'-terminal guanosine ribose exists in an equilibrium between S- and N-type conformations. All three guanosine bases adopt the syn conformation, with chi approximately 70 degrees. The results indicate that the solution structure of Z-RNA is very similar to that of Z-DNA.

Base Sequence

Conformation and dynamics of an RNA internal loop.

The conformation and the dynamics of an RNA oligonucleotide (26 nucleotides) which is a model for loop E in eukaryotic 5S RNA have been investigated by one- and two-dimensional NMR. The central portion of the oligonucleotide contains two G A oppositions, a common feature of ribosomal RNAs. The exchangeable proton spectrum indicates that an internal loop separates two stems of four and five base pairs. This observation is not consistent with structures for loop E containing mismatched G.A base pairs proposed from chemical and enzymatic studies on Xenopus laevis 5S RNA. The nonexchangeable proton spectrum has been assigned by two-dimensional NMR. Scalar couplings from correlated experiments and interproton distances from NOESY experiments at short mixing times have been used to determine glycosidic angles, sugar puckers, and other conformational features. The conformation of the stems is very close to standard A-form RNA, and extensive base stacking continues into the internal loop. This result provides a structural basis for the large favorable enthalpy of duplex formation determined in thermodynamic studies. Unusual structural and dynamic features are localized in the nucleotides connecting the loop to the stems.

Animals

Conformational analysis of d(C3G3), a B-family duplex in solution.

NMR and circular dichroism studies of the duplex formed by the self-complementary DNA hexanucleotide d(C3G3) indicate that it is a B-type structure but differs from standard B-form. An analysis of NMR coupling constants within the deoxyribose moieties yields a 70% or greater contribution from pseudorotation phase angles corresponding to the C3'-exo conformation, a conformation similar to the C2'-endo conformation associated with B-form DNA. Intranucleotide interproton distances are consistent with a B-form structure, but some internucleotide distances are intermediate between A- and B-form structures. Circular dichroism spectra have B-form characteristics but also include an unusual negative band at 282 nm. The solution spectroscopic results are in contrast with X-ray crystallographic studies which find A-form structures for similar sequences.

Circular Dichroism

RNA folding: pseudoknots, loops and bulges.

The three-dimensional structures adopted by RNA molecules are crucial to their biological functions. The nucleotides of an RNA molecule interact to form characteristic secondary-structure motifs. Tertiary interactions orient these secondary-structure elements with respect to each other to form the functional RNA. Here we describe the basic structural elements with special emphasis on a novel tertiary motif, the pseudoknot.

Base Sequence

Effects of nucleotide bromination on the stabilities of Z-RNA and Z-DNA: a molecular mechanics/thermodynamic perturbation study.

The structures of ZI- and ZII-form RNA and DNA oligonucleotides were energy minimized in vacuum using the AMBER molecular mechanics force field. Alternating C-G sequences were studied containing either unmodified nucleotides, 8-bromoguanosine in place of all guanosine residues, 5-bromocytidine in place of all cytidine residues, or all modified residues. Some molecules were also energy minimized in the presence of H2O and cations. Free energy perturbation calculations were done in which G8 and C5 hydrogen atoms in one or two residues of Z-form RNAs and DNAs were replaced in a stepwise manner by bromines. Bromination had little effect on the structures of the energy-minimized molecules. Both the minimized molecular energies and the results of the perturbation calculations indicate that bromination of guanosine at C8 will stabilize the Z forms of RNA and DNA relative to the nonbrominated Z form, while bromination of cytidine at C5 stabilizes Z-DNA and destabilizes Z-RNA. These results are in agreement with experimental data. The destabilizing effect of br5C in Z-RNAs is apparently due to an unfavorable interaction between the negatively charged C5 bromine atom and the guanosine hydroxyl group. The vacuum-minimized energies of the ZII-form oligonucleotides are lower than those of the corresponding ZI-form molecules for both RNA and DNA. Previous x-ray diffraction, nmr, and molecular mechanics studies indicate that hydration effects may favor the ZI conformation over the ZII form in DNA. Molecular mechanics calculations show that the ZII-ZI energy differences for the RNAs are greater than three times those obtained for the DNAs. This is due to structurally reinforcing hydrogen-bonding interactions involving the hydroxyl groups in the ZII form, especially between the guanosine hydroxyl hydrogen atom and the 3'-adjacent phosphate oxygen. In addition, the cytidine hydroxyl oxygen forms a hydrogen bond with the 5'-adjacent guanosine amino group in the ZII-form molecule. Both of these interactions are less likely in the ZI-form molecule: the former due to the orientation of the GpC phosphate away from the guanosine ribose in the ZI form, and the latter apparently due to competitive hydrogen bonding of the cytidine 2'-hydroxyl hydrogen with the cytosine carbonyl oxygen in the ZI form. The hydrogen-bonding interaction between the cytidine hydroxyl oxygen and the 5'-adjacent guanosine amino group in Z-RNA twists the amino group out of the plane of the base. This may be responsible for differences in the CD and Raman spectra of Z-RNA and Z-DNA.

Bromine