Search PubMed⌕ Search

Biomedical subjects

I Sawada

Publications and source records attributed to I Sawada.

At least 19 recordsLinked to original sources

Domestic violence and women's mental health in Japan.

There are positive changes in both the social and legal understanding of domestic violence in Japan. However, the scope of the problem has not been investigated in depth and described in the Japanese nursing literature. This descriptive study of a random sample of 177 women investigated domestic violence and the relationship between domestic violence and the mental health of the victims. Sixty-seven per cent of the female respondents reported having experiences of physical, psychological and/or sexual abuse. Forty-seven per cent of the abused women achieved statistically significant General Health Questionnaire scores that indicated clinical depression or anxiety. The findings of this study will enable Japanese nurses to better assess and intervene on behalf of their patients. In addition, avenues for further nursing research are suggested.

Adult↗

Distance education for health centre staff in rural Japan.

We have evaluated a course delivered by videoconferencing to rural health centre staff in Hokkaido. The course focused on the planning and evaluation of community health interventions. It included four 90 min sessions and two follow-up sessions. Fourteen professional staff members (public health nurses, nutritionists and dental assistants) attended each class. Knowledge of community health-care planning and evaluation was higher at post-education testing than pre-education testing. Ratings for 'using a computer', 'using some computer software', 'using the Internet' and 'interest in telehealth' increased significantly in post-education testing compared with pre-education testing. The course had an additional benefit in increasing the collaboration between community health workers and university staff.

Adult↗

Upgrading rural Japanese nurses' respiratory rehabilitation skills through videoconferencing.

We examined the effect of distance learning on nurses' clinical skills in a rural Japanese hospital. The subject matter was respiratory rehabilitation. After one face-to-face session, who 30 min sessions were delivered by videoconferencing to staff nurses working in a 100-bed rural hospital 250 miles (400 km) from Sapporo Medical University. A self-rating questionnaire was distributed before and after the sessions. Responses were collected from 15 out of 32 nurses participating in the face-to-face session (47%). Before the first videoconferencing session, 'always use' and 'sometime use' the new skills were rated by 67% of nurses, but after the second videoconferencing session 'always use' and 'sometimes use' were rated by 73% and 'never use' at 0%. This implies that there was increased use of new skills after the second session, although the difference was not significant. The nurses' opinions about the effectiveness for patients increased from 8% to 27% after the second session, which was significant. The pilot project indicated the usefulness of distance learning for upgrading nurses' clinical practice in one rural Japanese hospital and suggested ways in which videoconferencing can be used in future.

Attitude of Health Personnel↗

Swimming test for evaluating vestibular function in guinea pigs.

A swimming test was used to evaluate vestibular function in guinea pigs. We first observed tracings of the swimming patterns of 20 healthy guinea pigs to establish the normal range. Then the same test was used in a group of 49 guinea pigs with endolymphatic hydrops induced by immunologic techniques. They did not show spontaneous nystagmus or body deviation while walking, but a total of 20 out of 49 animals displayed abnormal swimming patterns, with 8 swimming clockwise and 4 counterclockwise. This swimming test is easily able to detect mild vestibular dysfunction in guinea pigs, and can be repeated, so that we consider it useful for examining vestibular function in these animals.

Animals↗

[A longitudinal study of brain atrophy and its relation with background factors and common carotid hemodynamics].

This longitudinal study was performed to clarify the relation between brain atrophy and common carotid hemodynamics. A total of 147 patients, including 70 males and 77 females, who had neither neurologic deficits nor organic lesions on computed tomography of the brain, were enrolled in this study. The ages of the patients ranged from 47 to 76 years (mean: 62 years) at the first diagnosis of brain atrophy. The patients were divided into three groups: 66 controls without hypertension or diabetes mellitus (Group I), 60 with hypertension (Group II) and 21 with both hypertension and diabetes mellitus (Group III). Brain atrophy was diagnosed by caudate head index (CHI). Mean blood flow volume (BF) at the right common carotid artery was measured by an ultrasonic quantitative flow measurement system. Both CHI and BF were measured twice at a mean interval 6.5 years. Increment in CHI per year (delta CHI) and decrement in mean blood flow volume per year (delta BF) were calculated. delta CHI of Group I and Group II had a significant relation with aging. delta CHI of Group III showed a larger increase than that of both Group I and Group II in subjects in the sixties. delta CHI had a significant relation with delta BF in each group. These results indicate that complication of both HT and DM, or decrement in mean blood flow volume may cause brain atrophy to progress.

Aged↗

Pathogenesis of widened AP-SP complex in cases of cerebellopontine angle tumors.

Pathogenesis of widened AP-SP complexes often noted in electrocochleograms (ECochGs) in cases of cerebellopontine angle tumors remains unclear. As acoustic neuromas usually originate from the vestibular nerve, some changes in this nerve might be involved in producing the broadened waveform. Effects of lidocaine on the AP-SP complex were investigated in guinea pigs by injecting this compound into the root exit zone of the vestibular nerve, where the cochlear efferent fibers run together. The AP-SP complex in response to clicks and tone bursts was recorded at the bony wall of the scala vestibuli in the basal turn of the cochlea. Inactivation of the efferent cochlear fibers resulted in a marked widening of the waveform, independent of the interstimulus intervals (ISIs). This broad wave was composed of a DC shift which was quite similar to the envelope curve of the acoustic stimuli. Although the effect of activity of the efferent cochlear fibers on negative summating potential (SP) has not been reported in detail, the authors concluded that the broad waveform observed in ECochGs in cases with cerebellopontine angle tumors was caused by enhanced negative SP due to inactivation of efferent cochlear fibers.

Animals↗

Vascular effects of isosorbide dinitrate on the common carotid artery in human volunteers.

The effects of 20 mg of orally administered isosorbide dinitrate (ISDN, Isocoronal R; CAS 87-33-2) on cerebral hemodynamics were investigated in 14 normal healthy volunteers (average age 32.6 years). The common carotid artery hemodynamics in the right supraclavicular region were measured using an ultrasonic quantitative flow measurement system. 2 h after drug administration, systolic blood pressure (15.5 mmHg, p less than 0.001) and mean blood pressure (7.2 mmHg, p less than 0.02) decreased significantly, but diastolic blood pressure did not change. A decrease in blood flow volume (2.85 ml/s, p less than 0.001) and blood flow velocity (7.00 cm/s, p less than 0.001), and an increase in mean vessel diameter (0.19 mm, p less than 0.05), and volume elasticity (0.68 x 10(5) dyn/cm2, p less than 0.02) were observed with ISDN. Mean vessel diameter increased gradually and reached its maximum at 4 h. However, the other maximal effects of ISDN were exerted at about 2 h. The ultrasonic quantitative flow measurement system was found to be useful in the case of repetitive measurements of the common carotid artery hemodynamics. It has been demonstrated that ISDN (20 mg/subject, p.o.) increases the diameter of the common carotid artery, although it decreases the blood flow in the common carotid artery.

Adult↗

Transcription analysis, physical mapping, and molecular characterization of a nonclassical human leukocyte antigen class I gene.

The human major histocompatibility complex contains approximately 20 class I genes, pseudogenes, and gene fragments. These include the genes for the three major transplantation antigens, HLA-A, HLA-B, and HLA-C, as well as a number of other genes or pseudogenes of unknown biological significance. Most of the latter have C + G-rich sequences in their 5' ends that are unmethylated in the B-lymphoblastoid cell line 3.1.0. We investigated one of these genes, HLA-H, in more detail. The gene is, overall, strongly homologous in sequence to HLA-A but differs in several potentially significant ways, including changes in conserved promoter sequences, a single-base deletion producing a translation termination codon in exon 4, and a region of sequence divergence downstream of the transcribed portion of the gene. Nevertheless, mouse L cells transfected with the gene accumulated small amounts of apparently full-length polyadenylated RNA. A portion of this RNA begins at the transcription site predicted by analogy to certain class I cDNA clones, while another portion appears to begin shortly upstream. L cells transfected with a hybrid gene containing the first three exons of HLA-H and the last five exons of HLA-B27 accumulated full-length HLA transcripts at the same level as cells transfected with an HLA-B27 gene; both levels are at least 15- to 20-fold higher than that directed by HLA-H alone. In addition, we isolated a cDNA clone for HLA-H that contains a portion of intron 3 attached to a normally spliced sequence comprising exons 4 through 8. These results suggest that low levels of translatable mRNA for the truncated class I heavy chain encoded by HLA-H are produced under physiologic circumstances and that sequences 3' of intron 3 decrease the levels of stable transcripts.

Amino Acid Sequence↗

Vapor compression distiller and membrane technology for water revitalization.

Water revitalization for a space station can consist of membrane filtration processes and a distillation process. Water recycling equipment using membrane filtration processes was manufactured for ground testing. It was assembled using commercially available components. Two systems for the distillation are studied; one is an absorption type thermopervaporation cell and the other is a vapor compression distiller. Absorption type thermopervaporation able to easily produce condensed water under zero gravity was investigated experimentally and through simulated calculation. The vapor compression distiller was studied experimentally and it offers significant energy savings for evaporation of water.

Absorption↗

Induction of experimental endolymphatic hydrops by immunologic techniques.

Immunologic techniques have been used by many investigators to produce experimental endolymphatic hydrops models. These techniques, however, have achieved little success in producing models simulating the idiopathic endolymphatic hydrops of Meniere's disease, in which no inflammatory changes occur in the perilymphatic spaces. In this study, the antigen horseradish peroxidase (HRP) was injected into the endolymphatic sacs of ninety guinea pigs that had been systematically sensitized to this antigen. Endolymphatic hydrops was induced in sixty-seven of the subjects, sixty-four of which showed no inflammatory changes in the perilymphatic spaces. The endolymphatic sacs of the affected guinea pigs were packed with soft granulation tissue induced by immunologic mechanisms; it is felt that the hydrops was caused by disturbances in endolymph absorption resulting from these tissue formations. Our results suggest that the introduction of antigens into the endolymphatic sac may prove useful in producing endolymphatic hydrops with characteristics similar to those occurring in Meniere's disease.

Animals↗

Primate evolution of the alpha-globin gene cluster and its Alu-like repeats.

The arrangement of alpha-globin genes in Old World and New World monkeys and a prosimian, galago, has been determined by restriction mapping. Recombinant DNAs containing galago and Old World monkey alpha-globin genes have been isolated and subjected to a partial sequence determination for comparison to alpha-globin genes in human, chimpanzee and non-primate mammals. The results of this extensive structural analysis are relevant to several topics concerning the evolution of primate alpha-globin genes and Alu family repeats. All orders of higher primates (i.e. Old and New World monkeys, chimpanzee and human) have the same arrangement of alpha-globin genes. In contrast, the arrangement and correction of galago alpha-globin genes differ from those of higher primates, but are similar to those of non-primate mammals. The 5' and 3'-flanking regions of the human alpha 1 gene are orthologous to the corresponding region in galago, identifying the human alpha 2 gene as the more recently duplicated gene. The human psi alpha 1 gene is found to be inactivated after divergence of the human and galago lineages but prior to the divergence of human and monkey. Orthologous Alu family members in human and monkey DNAs indicate that the dispersion of some Alu repeats occurred prior to the divergence of these lineages. However, the Alu-like repeats of prosimian and higher primates result from entirely independent events giving rise to different repeat elements inserted at distinct genomic positions.

Animals↗

A previously undetected pseudogene in the human alpha globin gene cluster.

The sequence of the DNA between two pseudogenes in the human alpha-like globin gene cluster has been determined. Comparison of this sequence with sequences from other alpha-like globin gene clusters revealed another pseudogene, psi alpha 2, between the previously recognized pseudogenes zeta 1 and psi alpha 1. Therefore, the human alpha-like globin gene family is organized 5'-zeta 2-zeta 1-psi alpha 2-psi alpha 1-alpha 2-alpha 1-3'. The new pseudogene psi alpha 2 is very close to zeta 1, beginning only 65 base pairs 3' to the polyadenylation site of zeta 1. The first exon and the first intron of psi alpha 2 are interrupted by large inserts which are flanked by short (6 to 8 base pairs) direct repeats. The pseudogene psi alpha 2 lacks a promoter for transcription by RNA polymerase II, the first exon is highly divergent, one splice site is mutated, and five different frameshift mutations have occurred in the coding regions. Thus psi alpha 2 cannot encode a globin polypeptide. This pseudogene was not recognized in previous hybridization analyses of the human alpha-like globin gene cluster, and our discovery of it by sequence analysis suggests that divergent copies of a large number of genes may comprise a substantial fraction of the slowly renaturing DNA of mammalian genomes.

Base Sequence↗

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac.

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X + 3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.

Animals↗

Evolution of Alu family repeats since the divergence of human and chimpanzee.

The DNA sequences of three members of the Alu family of repeated sequences located 5' to the chimpanzee alpha 2 gene have been determined. The base sequences of the three corresponding human Alu family repeats have been previously determined, permitting the comparison of identical Alu family members in human and chimpanzee. Here we compare the sequences of seven pairs of chimpanzee and human Alu repeats. In each case, with the exception of minor sequence differences, the identical Alu repeat is located at identical sites in the human and chimpanzee genomes. The Alu repeats diverge at the rate expected for nonselected sequences. Sequence conversion has not replaced any of these 14 Alu family members since the divergence between chimpanzee and human.

Animals↗

Intergenic DNA sequences flanking the pseudo alpha globin genes of human and chimpanzee.

We have determined the sequence of 2400 base pairs upstream from the human pseudo alpha globin (psi alpha) gene, and for comparison, 1100 base pairs of DNA within and upstream from the chimpanzee psi alpha gene. The region upstream from the promoter of the psi alpha gene shows no significant homology to the intergenic regions of the adult alpha 2 and alpha 1 globin genes. The chimpanzee gene has a coding defect in common with the human psi alpha gene, showing that the product of this gene, if any, was inactivated before the divergence of human and chimpanzee. However the chimpanzee gene contains a normal ATG initiation codon in contrast to the human gene which has GTG as the initiation codon. The psi alpha genes of both human and chimpanzee are flanked by the same Alu family member. The structure and position of this repeat have not been altered since the divergence of human and chimpanzee, and it is at least as well conserved as its immediate flanking sequence. Comparing human and chimpanzee, the 300 bp Alu repeat has accumulated only two base substitutions and one length mutation; the adjacent 300 bp flanking region has accumulated five base substitutions and twelve length mutations.

Animals↗