Search PubMed⌕ Search

Biomedical subjects

I M Russu

Publications and source records attributed to I M Russu.

At least 19 recordsLinked to original sources
PubMed2001

Proton exchange and local stability in a DNA triple helix containing a G.TA triad.

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C(+).GC triad. The results indicate that, in the G.TA triad, the stability of the Watson-Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6-1.8 kcal/mol at 1 degrees C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.

Adenine↗
PubMed2001

Proton exchange and base pair opening in a DNA triple helix.

Nuclear magnetic resonance spectroscopy has been used to characterize opening reactions and stabilities of individual base pairs in two related DNA structures. The first is the triplex structure formed by the DNA 31-mer 5'-AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT-3'. The structure belongs to the YRY (or parallel) family of triple helices. The second structure is the hairpin double helix formed by the DNA 20-mer 5'-AGAGAGAACCCCTTCTCTCT-3' and corresponds to the duplex part of the YRY triplex. The rates of exchange of imino protons with solvent in the two structures have been measured by magnetization transfer from water and by real-time exchange at 10 degrees C in 100 mM NaCl and 5 mM MgCl2 at pH 5.5 and in the presence of two exchange catalysts. The results indicate that the exchange of imino protons in protonated cytosines is most likely limited by the opening of Hoogsteen C+G base pairs. The base pair opening parameters estimated from imino proton exchange rates suggest that the stability of individual Hoogsteen base pairs in the DNA triplex is comparable to that of Watson-Crick base pairs in double-helical DNA. In the triplex structure, the exchange rates of imino protons in Watson-Crick base pairs are up to 5000-fold lower than those in double-helical DNA. This result suggests that formation of the triplex structure enhances the stability of Watson-Crick base pairs by up to 5 kcal/mol. This stabilization depends on the specific location of each triad in the triplex structure.

Base Pairing↗
PubMed2001

Allosteric free energy changes at the alpha 1 beta 2 interface of human hemoglobin probed by proton exchange of Trp beta 37.

The energetic changes that occur on ligand binding in human hemoglobin have been investigated by measurements of the exchange rates of the indole proton of Trpbeta37(C3). The Trpbeta37 residues are located in helices C of the beta-subunits and are involved in contacts with the segments FG of the alpha-subunits at the interdimeric alpha1beta2 and alpha2beta1 interfaces of the hemoglobin tetramer. In the quaternary structure change that accompanies ligand binding to hemoglobin, these contacts undergo minimal changes in relative orientation and in packing, thereby acting as hinges, or flexible joints. The exchange rates of the indole proton of Trpbeta37(C3) were measured by nuclear magnetic resonance spectroscopy, in both deoxygenated and ligated hemoglobin. The results indicate that, at 15 degrees C, the exchange rate is increased from 9.0. 10(-6) to 3.3. 10(-4) s(-1) upon ligand binding to hemoglobin. This change suggests that the structural units at the hinge regions of the alpha1beta2/alpha2beta1 interfaces containing Trpbeta37(C3) are specifically stabilized in unligated hemoglobin, and experience a change in structural free energy of approximately 4 kcal/(mol tetramer) upon ligand binding. Therefore, the hinge regions of the alpha1beta2/alpha2beta1 interfaces could play a role in the transmission of free energy through the hemoglobin molecule during its allosteric transition.

Amino Acid Substitution↗
PubMed2001

A signature of the T ---> R transition in human hemoglobin.

Allosteric effects in hemoglobin arise from the equilibrium between at least two energetic states of the molecule: a tense state, T, and a relaxed state, R. The two states differ from each other in the number and energy of the interactions between hemoglobin subunits. In the T state, constraints between subunits oppose the structural changes resulting from ligand binding. In the R state, these constraints are released, thus enhancing ligand-binding affinity. In the present work, we report the presence of four sites in hemoglobin that are structurally stabilized in the R relative to the T state. These sites are His alpha 103(G10) and His alpha 122(H5) in each alpha subunit of hemoglobin. They are located at the alpha(1)beta(1) and alpha(2)beta(2) interfaces of the hemoglobin tetramer, where the histidine side chains form hydrogen bonds with specific residues from the beta chains. We have measured the solvent exchange rates of side chain protons of His alpha 103(G10) and His alpha 122(H5) in both deoxygenated and ligated hemoglobin by NMR spectroscopy. The exchange rates were found to be higher in the deoxygenated-T than in ligated-R state. Analysis of exchange rates in terms of the local unfolding model revealed that the structural stabilization free energy at each of these two histidines is larger by approximately 1.5 kcal/(mol tetramer) in the R relative to the T state. The location of these histidines at the intradimeric alpha(1)beta(1) and alpha(2)beta(2) interfaces also suggests a role for these interfaces in the allosteric equilibrium of hemoglobin.

Adult↗
PubMed1999

Rotational dynamics of adenine amino groups in a DNA double helix.

Exocyclic amino groups of the bases undergo conformational fluctuations that affect the recognition and reactivity of nucleic acid molecules. Among these fluctuations, rotation of amino groups around C-N bonds is of special interest. In the present paper, we report the first determination of the rates and energetic parameters for rotation of the N6-amino group of adenine in a DNA double helix. The DNA molecule studied is the dodecamer [d(CGCGAGCTCGCG)]2. The adenine in each A. T basepair of the dodecamer was labeled with 15N at the N6 position, and the NMR resonances of the two protons in the adenine amino group were selectively observed by 15N-editing methods. The rates of rotation of the amino group were obtained from experiments of transfer of magnetization between the two protons in the same group and from lineshape analysis of 15N-edited amino proton NMR resonances. The results show that, over the temperature range from 0 to 70 degrees C, the rates of rotation of adenine amino groups range from 60 to 24,000 s-1. Formation of the activated state during rotation has a standard enthalpy change of 15.3 +/- 0.2 kcal/mol and a standard entropy change of 6.0 +/- 0.7 cal/(mol. K). Analysis of the results suggests that rotation of the amino group occurs in the paired, closed state of the adenine in the A. T basepair of the double-helical DNA structure.

Adenine↗
PubMed1997

Assembly of human hemoglobin. Studies with Escherichia coli-expressed alpha-globin.

The alpha-globin of human hemoglobin was expressed in Escherichia coli and was refolded with heme in the presence and in the absence of native beta-chains. The functional and structural properties of the expressed alpha-chains were assessed in the isolated state and after assembly into a functional hemoglobin tetramer. The recombinant and native hemoglobins were essentially identical on the basis of sensitivity to effectors (Cl- and 2,3-diphosphoglycerate), Bohr effect, CO binding kinetics, dimer-tetramer association constants, circular dichroism spectra of the heme region, and nuclear magnetic resonance of the residues in the alpha1beta1 and alpha1beta2 interfaces. However, the nuclear magnetic resonance revealed subtle differences in the heme region of the expressed alpha-chain, and the recombinant human normal adult hemoglobin (HbA) exhibited a slightly decreased cooperativity relative to native HbA. These results indicate that subtle conformational changes in the heme pocket can alter hemoglobin cooperativity in the absence of modifications of quaternary interface contacts or protein dynamics. In addition to incorporation into a HbA tetramer, the alpha-globin refolds and incorporates heme in the absence of the partner beta-chain. Although the CO binding kinetics of recombinant alpha-chains were the same as that of native alpha-chains, the ellipticity of the Soret circular dichroism spectrum was decreased and CO binding kinetics revealed an additional faster component. These results show that recombinant alpha-chain assumes alternating conformations in the absence of beta-chain and indicate that the isolated alpha-chain exhibits a higher degree of conformational flexibility than the alpha-chain incorporated into the hemoglobin tetramer. These findings demonstrate the utility of the expressed alpha-globin as a tool for elucidating the role of this chain in hemoglobin structure-function relationships.

Adult↗
PubMed1996

Base-catalysis of imino proton exchange in DNA: effects of catalyst upon DNA structure and dynamics.

Characterization of the kinetics and energetics of base-pair opening in nucleic acids relies upon measurements of the rates of exchange of imino protons with water protons at high concentrations of the exchange catalyst. Under these conditions, the exchange catalyst may affect structural or dynamic properties of the nucleic acid molecule and thus, limit the significance of the exchange data. To address this problem, we have used NMR spectroscopy to characterize the effects of a catalyst of imino proton exchange, namely, ammonia upon the structure and dynamics of the self-complementary DNA dodecamer [d(CGCAGATCTGCG)]2. The changes in structure were monitored in proton NOESY and DQF-COSY experiments and in phosphorus spectra at 15 degrees C and at ammonia concentrations ranging from 0.002 to 0.5 M. The results indicate that ammonia induces subtle changes in the solution conformation of the dodecamer, but the overall structure is maintained close to the B-type DNA structure. However, the relaxation rates (i.e., transverse, longitudinal, and cross-relaxation rates) of several non-exchangeable protons were found to increase by approximately 50% upon changing ammonia concentration from 0.002 to 0.5 M. The increases were comparable for all protons investigated suggesting that they originate from an ammonia-induced increase in the overall correlation time of the DNA dodecamer. Numerical analysis revealed that the catalyst-induced enhancements in proton relaxation can alter significantly the calculated values of the exchange rates of imino protons, especially those obtained from measurements of the line widths of these proton resonances.

Alkalies↗
PubMed1995

Energetics of base pair opening in a DNA dodecamer containing an A3T3 tract.

Nuclear magnetic resonance spectroscopy has been used to characterize the kinetics and energetics of opening of base pairs in the DNA dodecamer [d(CGCAAATTTGCG)]2. The dodecamer contains an A3T3 tract that induces intrinsic curvature of the helix axis. Previous studies from this and other laboratories have shown that the kinetics of base pair opening in AnTn tracts is unique: the opening rates of the A.T base pairs in the interior of the tract are much lower than that of the A.T base pair at the 5'-end of the tract. In the present work, we have investigated the energetics of the pathways for opening of the A.T base pairs in the A3T3 tract. The energetic parameters of the activated state(s) are obtained from the temperature dependence of the opening rate constants. The lower opening rates for the A.T base pairs situated in the interior of the tract are shown to originate from higher activation enthalpies which are compensated, in part, by increases in the activation entropies. We have also obtained an energetic characterization of the open state(s) of the A.T base pairs in the dodecamer by measuring the equilibrium constants for base pair opening and their temperature dependence. The results suggest that the transitions from closed to open state(s) in the A.T base pairs of the A3T3 tract are energetically similar.

Base Composition↗
PubMed1994

Sequence dependence of base-pair opening in a DNA dodecamer containing the CACA/GTGT sequence motif.

Proton nuclear magnetic resonance spectroscopy is used to characterize the kinetics and energetics of base-pair opening in two self-complementary DNA dodecamer duplexes: [d(CGCACATGTGCG)]2 and [d(CGCAGATCTGCG)]2. The first dodecamer contains two symmetrical CACA/GTGT motifs; in the second dodecamer, each motif is interrupted by a change of the central C.G base pair to a G.C base pair. The opening rates and the equilibrium constants for formation of the open state of each base pair are obtained from the dependence of the imino proton exchange rates on the concentration of ammonia catalyst. The results indicate that the opening rates of the central three base pairs in the CACA/GTGT motif are 3-8-fold larger than the corresponding ones in the CAGA/GTCT sequence. The activation enthalpies and entropies, and the standard enthalpy and entropy changes for formation of the open state, are obtained from the temperature dependence of the opening rates and equilibrium constants, respectively. The results reveal that enthalpy/entropy compensation exists, for all base pairs in both dodecamers, in activation as well as in the equilibria between closed and open states. As a result, the opening rates and equilibrium constants for opening are maintained, in both dodecamers, within a relatively narrow range of values. Nevertheless, large sequence-induced variations are observed for the activation enthalpies and the standard enthalpy changes for opening. The A.T base pair located between the C.G base pairs in the CACA/GTGT motif has a negative enthalpy change for formation of the activated state during opening. This is the first case in which a negative activation enthalpy is observed for opening of a Watson-Crick base pair in DNA.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Composition↗
PubMed1993

Determination of distances involving exchangeable protons from NOESY spectra of two DNA dodecamers.

Two-dimensional proton nuclear Overhauser effect (NOESY) spectra were obtained as a function of mixing time for two DNA dodecamers, 5'-CGCGAATTCGCG-3' and 5'-CGCAAATTTGCG-3', in aqueous solutions. The time evolution of cross-peak volumes was quantitatively analyzed based on the approximate solution of the relaxation/exchange equation over a range of mixing times from 30 to 150 ms. Inter-proton distances, involving exchangeable protons in key locations of the structures, were calculated and compared to the distances predicted by the crystal structures. These NMR-derived distances enhance the number of constraints, and their accuracy, for determination of solution structures of the two DNA dodecamers.

Base Sequence↗
PubMed1993

Sequence dependence of purine C8H exchange kinetics in the dodecamer 5'-d(CGCGAATTCGCG)-3'.

Proton nmr spectroscopy is used to measure the deuterium exchange rates of C8 protons in individual purines of the dodecamer 5'-d(CGCGAATTCGCG)-3' and their temperature dependence. In perfect agreement with results from tritium labeling and laser Raman spectroscopy, we find that the DNA secondary structure retards the rates of purine C8H exchange. The largest effects are observed for the C8 protons of adenines whose rates of exchange at 40 degrees C are 3- to 4-fold lower than that in 5'-adenosine monophosphate. Moreover, the retardation of exchange at the central adenine is greater than that at its 5'-neighbor. For the guanines, the exchange rates are up to 2-fold lower than that in 5'-guanosine monophosphate, and the largest retardation is observed for the bases at positions 10 and 12. A dependence on base sequence is also observed for the activation energy for exchange. The activation energy is largest for the adenines and its value is 4 kcal/mol higher than that in 5'-adenosine monophosphate. The lowest activation energy is observed for the guanine in position 4 and the value is the same as in 5'-guanosine monophosphate. These results demonstrate the sensitivity of the purine C8H exchange kinetics to sequence-dependent conformational features of B-DNA in solution state.

Base Sequence↗
PubMed1992

Kinetics and energetics of base-pair opening in 5'-d(CGCGAATTCGCG)-3' and a substituted dodecamer containing G.T mismatches.

Proton nuclear magnetic resonance (NMR) spectroscopy is used to characterize the kinetics and energetics of base-pair opening in the dodecamers 5'-d(CGCGAATTCGCG)-3' and 5'-d(CGCGAATTTGCG)-3'. The latter dodecamer contains two symmetrical G.T mismatched base pairs. The exchange kinetics of imino protons is measured from resonance line widths and selective longitudinal relaxation times. For the G.T pair, the two imino protons (G-N1H and T-N3H) provide probes for the opening of each base in the mismatched pair. The lifetimes of individual base pairs in the closed state and the equilibrium constants for formation of the open state are obtained from the dependence of the exchange rates on the concentration of ammonia catalyst. The activation energies and standard enthalpy changes for base-pair opening are obtained from the temperature dependence of the lifetimes and equilibrium constants, respectively. The results indicate that the G.T mismatched pairs are kinetically and energetically destabilized relative to normal, Watson-Crick base pairs. The lifetimes of the G.T pairs are of the order of 1 ms or less, over the temperature range from 0 to 20 degrees C. The equilibrium constants for base-pair opening, at 20 degrees C, are increased up to 4000-fold, relative to those of normal base pairs. The energetic destabilization of the G.T base pairs is, at least in part, enthalpic in origin. The presence of the G.T mismatched base pairs destabilizes also neighboring base pairs.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Composition↗
PubMed1991

Crystal and molecular structure of a DNA fragment: d(CGTGAATTCACG).

The crystal structure of the dodecanucleotide d(CGTGAATTCACG) has been determined to a resolution of 2.7 A and refined to an R factor of 17.0% for 1532 reflections. The sequence crystallizes as a B-form double helix, with Watson-Crick base pairing. This sequence contains the EcoRI restriction endonuclease recognition site, GAATTC, and is flanked by CGT on the 5'-end and ACG on the 3'-end, in contrast to the CGC on the 5'-end and GCG on the 3'-end in the parent dodecamer d(CGCGAATTCGCG). A comparison with the isomorphous parent compound shows that any changes in the structure induced by the change in the sequence in the flanking region are highly localized. The global conformation of the duplex is conserved. The overall bend in the helix is 10 degrees. The average helical twist values for the present and the parent structures are 36.5 degrees and 36.4 degrees, respectively, corresponding to 10 base pairs per turn. The buckle at the substituted sites are significantly different from those seen at the corresponding positions in the parent dodecamer. Step 2 (GpT) is underwound with respect to the parent structure (27 degrees vs 36 degrees) and step 3 (TpG) is overwound (34 degrees vs 27 degrees). There is a spine of hydration in the narrow minor groove. The N3 atom of adenine on the substituted A10 and A22 bases are involved in the formation of hydrogen bonds with other duplexes or with water; the N3 atom of guanine on G10 and G22 bases in the parent structure does not form hydrogen bonds.

Base Composition↗
PubMed1991

Studying DNA-protein interactions using NMR.

NMR spectroscopy is emerging as a powerful tool in molecular biology and biotechnology; one aspect of which is the use of one- and two-dimensional NMR methodologies to investigate the interactions of proteins with DNA. The dynamic and structural information which NMR can provide, on the changes in conformation and molecular flexibility, complements X-ray crystallography data and enables mechanistic models of DNA-protein interactions to be formulated.

Base Sequence↗
PubMed1990

1H and 31P nuclear magnetic resonance investigation of the interaction between 2,3-diphosphoglycerate and human normal adult hemoglobin.

High-resolution 1H and 31P nuclear magnetic resonance spectroscopy has been used to investigate the binding of 2,3-diphosphoglycerate to human normal adult hemoglobin and the molecular interactions involved in the allosteric effect of the 2,3-diphosphoglycerate molecule on hemoglobin. Individual hydrogen ion NMR titration curves have been obtained for 22-26 histidyl residues of hemoglobin and for each phosphate group of 2,3-diphosphoglycerate with hemoglobin in both the deoxy and carbonmonoxy forms. The results indicate that 2,3-diphosphoglycerate binds to deoxyhemoglobin at the central cavity between the two beta chains and the binding involves the beta 2-histidyl residues. Moreover, the results suggest that the binding site of 2,3-diphosphoglycerate to carbonmonoxyhemoglobin contains the same (or at least some of the same) amino acid residues responsible for binding in the deoxy form. As a result of the specific interactions with 2,3-diphosphoglycerate, the beta 2-histidyl residues make a significant contribution to the alkaline Bohr effect under these experimental conditions (up to 0.5 proton/Hb tetramer). 2,3-Diphosphoglycerate also affects the individual hydrogen ion equilibria of several histidyl residues located away from the binding site on the surface of the hemoglobin molecule, and, possibly, in the heme pockets. These results give the first experimental demonstration that long-range electrostatic and/or conformational effects of the binding could play an important role in the allosteric effect of 2,3-diphosphoglycerate on hemoglobin.(ABSTRACT TRUNCATED AT 250 WORDS)

Diphosphoglyceric Acids↗
PubMed1990

Proton exchange and base-pair opening kinetics in 5'-d(CGCGAATTCGCG)-3' and related dodecamers.

We have used nuclear magnetic resonance (NMR) spectroscopy to measure the lifetimes of individual base-pairs in the palindromic DNA oligonucleotide 5'-d(CGCGAATTCGCG)-3' and in three other dodecamers with symmetrical base substitutions in the sites underlined. The resonances of the hydrogen-bonded imino protons in each of the substituted oligomers in the duplex form have been assigned using one dimensional nuclear Overhauser effect (1-D NOE) experiments. The lifetimes have been obtained from the dependence of selective longitudinal relaxation times and linewidths of the imino proton resonances on the concentration of base catalyst (Tris) at 25 degrees C and in the presence of 50 mM NaCl. The lifetimes of the central A.T base-pairs have been found to depend on base sequence. They are greatly increased in the dodecamer 5'-d(CGCAAATTTGCG)-3' which contains an A3T3 tract. The lifetimes of the central A.T base-pairs in 5'-d(CGCGAATTCGCG)-3', 5'-d(CGCTAATTAGCG)-3' and 5'-d(CGCCAATTGGCG)-3' are comparable. In all dodecamers, the lifetime of the A.T base-pair at the 5'-end of the AnTn tract is the shortest. The anomalous opening kinetics of the A.T base-pairs can be correlated to the bending properties of the corresponding sequences.

Base Composition↗
PubMed1989

A proton nuclear magnetic resonance investigation of the anion Bohr effect of human normal adult hemoglobin.

High-resolution proton nuclear magnetic resonance spectroscopy has been used to investigate the molecular mechanism of the Bohr effect of human normal adult hemoglobin in the presence of two allosteric effectors, i.e., chloride and inorganic phosphate ions. The individual hydrogen ion equilibria of 22-26 histidyl residues of hemoglobin have been measured in anion-free 0.1 M HEPES buffer and in the presence of 0.18 M chloride or 0.1 M inorganic phosphate ions in both deoxy and carbonmonoxy forms. The results indicate that the beta 2-histidyl residues are strong binding sites for chloride and inorganic phosphate ions in hemoglobin. The affinity of the beta 2-histidyl residues for these anions is larger in the deoxy than in the carbonmonoxy form. Nevertheless, the contribution of these histidyl residues to the anion Bohr effect is small due to their low pK value in deoxyhemoglobin in anion-free solvents. The interactions of chloride and inorganic phosphate ions with the hemoglobin molecule also result in lower pK values and/or changes in the shapes of the hydrogen ion binding curves for several other surface histidyl residues. These results suggest that long-range electrostatic interactions between individual ionizable sites in hemoglobin could play an important role in the molecular mechanism of the anion Bohr effect.

Adult↗