Biomedical subjects

I Kim

Publications and source records attributed to I Kim.

At least 109 records · Page 6Linked to original sources

PubMed1995

Signal transfer through three compartments: transcription initiation of the Escherichia coli ferric citrate transport system from the cell surface.

Transport of ferric citrate into cells of Escherichia coli K-12 involves two energy-coupled transport systems, one across the outer membrane and one across the cytoplasmic membrane. Previously, we have shown that ferric citrate does not have to enter the cytoplasm of E. coli K-12 to induce transcription of the fec ferric citrate transport genes. Here we demonstrate that ferric citrate uptake into the periplasmic space between the outer and the cytoplasmic membranes is not required for fec gene induction. Rather, FecA and the TonB, ExbB and ExbD proteins are involved in induction of the fec transport genes independent of their role in ferric citrate transport across the outer membrane. The uptake of ferric citrate into the periplasmic space of fecA and tonB mutants via diffusion through the porin channels did not induce transcription of fec transport genes. Point mutants in FecA displayed the constitutive expression of fec transport genes in the absence of ferric citrate but still required TonB, with the exception of one FecA mutant which showed a TonB-independent induction. The phenotype of the FecA mutants suggests a signal transduction mechanism across three compartments: the outer membrane, the periplasmic space and the cytoplasmic membrane. The signal is triggered upon the interaction of ferric citrate with FecA protein. It is postulated that FecA, TonB, ExbB and ExbD transfer the signal across the outer membrane, while the regulatory protein FecR transmits the signal across the cytoplasmic membrane to FecI in the cytoplasm. FecI serves as a sigma factor which facilitates binding of the RNA polymerase to the fec transport gene promoter upstream of fecA.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acid Sequence↗

PubMed1995

Differential effects of neuropeptides on the distal and mid-tubules of the house cricket.

In the Malpighian tubules of Acheta, the distal and middle segments are functionally and morphologically quite distinct (Spring and Kim, Mol Comp Physiol 12:130-145, 1993). Furthermore, they respond quite differently to corpora cardiaca (CC) homogenates, dibutyryl cAMP, and A23187 (Kim and Spring, J Insect Physiol 38:373-381, 1992). In this study we compared secretion by these two regions in response to Acheta and Romalea CC extracts, synthetic Manduca sexta diuretic peptide (Mas-DP1), and the family of synthetic myotropic peptides, the achetakinins, isolated from Acheta. Both Acheta and Romalea CC extracts had opposite effects on the two regions: mid-tubule secretion increased 3-fold whereas secretion by the distal segment declined 75-80%. Mas-DP1 increased secretion by the mid-tubule more than 3-fold and had no effect on the distal segment. All of the achetakinins decreased secretion by the distal tubule, with achetakinin 1 being least effective (55% inhibition) and achetakinin 5 being most effective (75% inhibition). Achetakinins 1 and 2 increased mid-tubule secretion by 3.7- and 3.3-fold, respectively, whereas the others had no effect on this region. Regarding HPLC fractions of CC extracts, in general the more hydrophilic fractions inhibited secretion by both distal and mid-tubules. The more hydrophobic fractions were nearly uniformly stimulatory when applied to the mid-tubule, and either inhibited secretion or had no effect on the distal region. The possible interpretations of these data and the implications towards future research are discussed.

Animals↗

PubMed1995

Cystic intrapulmonary lymphangioma: HRCT findings.

We report a rare case of cystic intrapulmonary lymphangioma involving the left lung, which presented with pneumothorax and respiratory distress in a 6-month-old infant. Chest radiographs showed a multicystic lesion in the left lung mimicking the features of congenital cystic adenomatoid malformation of the lung. The lesion appeared on high-resolution CT (HRCT) as a multiseptate, air-filled cystic lesion in the left hilar area. Associated HRCT findings were thickening of interlobular septa and bronchovascular bundles in the left lung and the presence of peripheral pulmonary vessels within cystic lesions in the apex of the left lung. HRCT findings correlated well with histopathologic findings. We suggest that these associated findings may be helpful in distinguishing this condition from other cystic lung diseases and that this entity should be included in the differential diagnosis of multicystic lung lesions.

Cystic Adenomatoid Malformation of Lung, Congenita↗

PubMed1995

Regulation of citrate-dependent iron transport of Escherichia coli: fecR is required for transcription activation by FecI.

Citrate-dependent Fe3+ transport into Escherichia coli K-12 is induced by iron and citrate. The inducer is probably ferric dicitrate which does not have to be taken up into the cytoplasm to induce transcription of the fec transport genes. Two regulatory genes, fecI and fecR, located upstream of the fecABCDE transport genes, are required for induction. We report that in vivo the chromosomally encoded FecI protein activates transcription of the fecA and fecB transport genes in response to ferric citrate and the FecR protein. Cells expressing chromosomally and plasmid-encoded truncated FecR derivatives no longer responded to ferric citrate and expressed the fec transport genes constitutively. The smallest active FecR derivative contained 59 amino acid residues as compared to the 317 residues of wild-type FecR. Constitutive induction was lower than induction of the FecR wild-type strain by ferric citrate. It is concluded that the N-terminal portion of FecR activates FecI and that the C-terminal portion of FecR responds to ferric citrate. Transcription of the fec transport genes is positively regulated by FecI and FecR and negatively regulated by the Fe2(+)-Fur repressor. Transcription activation and repression may occur independently of each other.

Amino Acid Sequence↗

PubMed1995

Regulation of proliferation and production of prostate-specific antigen in androgen-sensitive prostatic cancer cells, LNCaP, by dihydrotestosterone.

LNCaP is an androgen-sensitive human prostatic cancer cell line. The effect of androgen on these cells is characterized by a bell-shaped growth response and a dose-dependent induction of prostate-specific antigen (PSA) production. The present study was carried out to gain further insight into the effect of androgen on LNCaP. Cells were cultured in phenol red-free RPMI-1640 supplemented with 10% charcoal-stripped fetal bovine serum, with concentrations of dihydrotestosterone (DHT) ranging from 0-10(-7) M, in a 4-day culture system. A bell-shaped growth response was reproduced with a peak level of cell count at 10(-10) M DHT. PSA secretion from these cells did not increase significantly until the DHT level in the medium reached 10(-9) M. A progressive increase in PSA secretion was observed at higher DHT concentrations accompanied with a progressive decline in cellular proliferation. The results of immunocytochemical analysis of PSA localization indicated that the proportion of cells with positive staining for PSA also increased with increasing concentrations of DHT. Analysis of androgen receptors, as determined by both immunocytochemistry and Western blot analysis, showed a decline in nuclear androgen receptor at low concentrations of DHT and an increase in the amount of receptor protein at high concentrations. These results indicated that the androgen-induced bell-shaped growth response in LNCaP cells represented the manifestation of two different cellular events in dose-related manner: cellular proliferation at low DHT concentrations and increased production of PSA at high DHT concentrations.

Androgens↗

PubMed1995

Characterization of mucins and proteoglycans synthesized by a mucin-secreting HT-29 cell subpopulation.

HT-29 cells selected by adaptation to 10(-5) M methotrexate (HT-29 MTX) are a homogeneous cell population producing high amounts of mucin. Intracellular mucins and proteoglycans were isolated from these cells by ultracentrifugation of cell lysates on a cesium bromide gradient and further separated by anion-exchange high performance liquid chromatography. The major mucin fraction isolated was characterized by a high hydroxy amino acid content (40%), a Thr/Ser ratio of 1.52, a high sialic acid content, and a low sulfate content. When the same procedure was applied to undifferentiated HT-29 cells, a minor mucin fraction was isolated which appeared less sialylated and more sulfated. The major proteoglycan species identified in HT-29 MTX cells showed less acidic behavior than the proteoglycan isolated from HT-29 cells. The effect of brefeldin A and the sugar analog GalNAc-alpha-O-benzyl on the synthesis and biochemical properties of mucins synthesized by HT-29 MTX cells was examined. Brefeldin A induced the synthesis of more-sulfated mucins. GalNAc-alpha-O-benzyl treatment resulted in mucins with an increased content of T antigen and a 13-fold lower sialic acid content. We show that GalNAc-alpha-O-benzyl was metabolized by the cells to Gal beta 1-3GalNAc-alpha-O-benzyl, which, in turn, was a potent competitive inhibitor of the O-glycan alpha-2,3-sialyltransferase. These results illustrate the suitability of HT-29 MTX cells as a model to analyse mucin synthesis and sialylation.

Acetylgalactosamine↗

PubMed1995

Selective deuteration of RNA for NMR signal assignment.

For site-selective deuterium labeling of RNA, [5-2H]uridine phosphoramidite was prepared. The uridine at position 10 of a 25-mer RNA, GGACAGACUUCGGUCGGAGUACUCG, was labeled in two different manners for "positive" (U = [5-1H]U, U = [5-2H] U) and "negative"(U = [5-2H]U, U = [5-1H]U) observations. By comparison of NOESY spectra of the two labeled samples with that of the unlabeled RNA, we could unambiguously assign the H5-H6 signals of U10, and measure their NOE connectivities.

Base Sequence↗

PubMed1994

Antibody-dependent neutrophil-mediated killing of Acanthamoeba castellanii.

Neutrophils from naive rats lysed low numbers of Acanthamoeba castellanii in the presence of normal rat serum and significantly higher numbers of the parasite in the presence of serum from immunized rats. With normal rat serum, neutrophils from rats immunized with crude parasite extract or from naive rats killed similar percentages of A. castellanii. However, neutrophils from immunized rats killed a significantly greater percentage of parasites in the presence of serum from immunized rats than was seen with any other combination of serum and neutrophils. The addition of supernatant from cultures of concanavalin A-stimulated rat spleen cells to incubations of the parasite in the presence of neutrophils from naive or immunized rats and immune serum resulted in the highest levels of amoebolysis seen in this study. This study has shown that neutrophils from naive rats or from rats immunized with A. castellanii antigen display a very limited amoebolytic capability which is significantly augmented in the presence of serum from immunized rats and further boosted by the addition of supernatant from Con A-stimulated rat spleen cell cultures.

Acanthamoeba↗

PubMed1994

Histogenetic consideration of ovarian sex cord-stromal tumors analyzed by expression pattern of cytokeratins, vimentin, and laminin. Correlation studies with human gonads.

A total of 30 sex cord-stromal tumors including 9 adult type and 5 juvenile type granulosa cell tumors (GCTs), 4 Sertoli-Leydig cell tumors (SLTs), 1 gynandroblastoma, 5 thecomas, 2 fibromas and 3 sclerosing stromal tumors were immunohistochemically evaluated by means of cytokeratins of different molecular weight, vimentin and laminin with regard to the histogenesis of these tumors and to the embryogenesis of the sex cord and stroma of developing gonads. For comparison, 7 embryonic gonads, 9 fetal and 9 adult ovaries, 14 fetal and 5 postnatal testes, and 1 gonadoblastoma were also examined. The coelomic epithelium of all gonads were positive for both cytokeratins (CAM 5.2 and AE1) and vimentin. In fetal ovaries, the granulosa cells of primordial follicles express low molecular weight cytokeratins only and those cells of more maturing follicles did not express any cytokeratin or vimentin. In adult ovaries, the granulosa cells of primordial follicles coexpressed low molecular weight cytokeratins and vimentin, but those cells of more maturing follicles expressed vimentin only. In fetal testes before 20 weeks gestational age, the Sertoli and Leydig cells did not express any cytokeratins and vimentin. After that time, both cells expressed vimentin only throughout life. The rete ovarii and rete testis from fetal to adult life coexpressed both low molecular weight cytokeratins and vimentin. The rete ovarii in all ages and rete testis in prenatal and childhood ages were surrounded by the laminin-positive basement membrane, however, the rete testis in adult were not. In neoplasia, the GCTs, thecomas, fibromas, and sclerosing stromal tumors expressed vimentin only.(ABSTRACT TRUNCATED AT 250 WORDS)

Adult↗

PubMed1994

Cell surface expression and functional significance of adhesion molecules on human myeloma-derived cell lines.

Multiple myeloma is characterized by the presence of malignant plasma cells predominantly localized in bone marrow. Our prior studies have suggested that human myeloma derived-cell lines adhere specifically to fibronectin and to bone marrow stromal cells (BMSCs) via beta 1 and beta 2 integrins as well as RGD peptide, and that tumour cell to BMSC contact triggers interleukin-6 (IL-6) secretion from BMSCs. Since IL-6 is a growth factor for myeloma, adhesion may be important in paracrine IL-6 mediated tumour cell growth. We therefore examined phenotypic expression of adhesion molecules on the U266 and IM-9 human myeloma-derived cell lines using the panel of monoclonal antibodies (MoAbs) directed at adhesion molecules submitted to the Vth International Conference on Human Leukocyte Differentiation Antigens. U266 and IM-9 myeloma cell lines express mainly CD29, CD49d, VLA-1, CD18, CD54, ICAM-2 and ICAM-3. In contrast, CD49b, VLA-3, CD49f, CD11b, VCAM-1, selectins and selectin-ligands were not expressed on these cell lines. Specific adherence of IM-9 cells to BMSC line LP101 was demonstrated which could be partially blocked by pre-incubation and culture of tumour cells with anti-beta 1 integrin, anti-beta 2 integrin, anti-CD49d, anti-VLA-5, anti-CD11a, anti-CD44 and anti-CD54 MoAbs. The combination of these MoAbs (anti-CD29, CD18, CD11a, CD49d, VLA-5, CD44, CD54, ICAM-2, ICAM-3 MoAbs) decreased but did not completely abrogate binding of IM-9 to BMSCs. Moreover, increases in IL-6 secretion from BMSCs after adherence of IM-9 cells were also partially blocked by these MoAbs. These findings suggest that multiple adhesion pathways may mediate adherence of myeloma cell lines to BMSCs, localizing tumour cells in the marrow microenvironment and triggering IL-6 secretion by BMSCs which may augment tumour cell growth.

Antibodies, Monoclonal↗

PubMed1994

Induction of stable microtubules in 3T3 fibroblasts by TGF-beta and serum.

Previous studies have shown that fibroblasts induced to migrate into an in vitro wound rapidly generate an array of stable, post-translationally detyrosinated microtubules (Glu MTs) oriented toward the direction of migration. To understand how cells generate a stable array of MTs at a specific location, we have analyzed the contribution of media components to the formation of oriented Glu MTs in wounded monolayers of 3T3 fibroblasts. When confluent monolayers were placed in serum-free medium (SFM) for 2 days before wounding, the cells contained virtually no Glu MTs or nocodazole-resistant MTs and were incapable of generating Glu MTs in response to wounding. Such SFM-treated monolayers were capable of generating oriented Glu MTs within 1 hour of wounding, if calf serum (CS) was added back to the medium. The Glu MTs in the CS refed cells were oriented toward the wound in cells at the wound edge, and were juxtanuclear in cells within the monolayer, demonstrating that CS restored the Glu MT array characteristic of each cell type. To determine the nature of the 'Glu MT-inducing' factor in CS, we subjected CS to different treatments and found that the CS factor was nondialyzable, resistant to heat, mild acid and trypsin, but inactivated by treatment with dithiothreitol. The factor was not absorbed by charcoal and was present in lipoprotein-deficient serum. These properties are consistent with the properties of a number of polypeptide growth factors, so we screened purified growth factors for their ability to induce Glu MTs in wounded SFM-treated monolayers. Of all the growth factors tested, only TGF-beta 1 and TGF-beta 2 induced a significant level (> or = 70% of the CS response) of oriented Glu MTs. The SFM-treated cells were exquisitely sensitive to TGF-beta 1, with significant induction of Glu MTs observed at 0.01 ng/ml TGF-beta 1. Induction of Glu MTs observed by immunofluorescence after CS or TGF-beta treatments were paralleled by increases in Glu tubulin detected on western blots. The Glu MTs formed after either CS or TGF-beta 1 treatment showed enhanced resistance to nocodazole, confirming that both treatments increased the level of stable MTs in cells. The TGF-beta 1 induction of stable MTs was slower than that of CS (2-4 hours onset versus 1 hour onset), but by 24 hours the level of MT stabilization in TGF-beta 1 was even greater than that in CS.(ABSTRACT TRUNCATED AT 400 WORDS)

3T3 Cells↗

PubMed1994

Vitamin A and E blood levels in erythrodermic and pustular psoriasis associated with chronic alcoholism.

Vitamin A and E blood levels were determined, using a high-performance liquid chromatographic method, in 7 patients with erythrodermic psoriasis or psoriatic acral pustulosis associated or not associated with chronic alcoholism, during and after the acute episode. These vitamins were also studied in 5 patients with psoriasis vulgaris involving more than 80% of the surface body area and associated with chronic alcohol intake and in 17 patients with psoriasis vulgaris involving more than 50% of the skin but without chronic alcoholism. Vitamin A blood levels were reduced in all the patients in the group "erythrodermic psoriasis/psoriatic acral pustulosis", while vitamin E blood levels were below the normal range during the acute psoriatic episode only in the 5 patients having a history of chronic alcohol intake in this group. In the other groups--psoriasis vulgaris with chronic alcoholism and psoriasis vulgaris without heavy alcohol consumption--vitamin A and E blood levels were not reduced. The implication of vitamin E in psoriasis, probably by its antioxidant activity, and its relationship with selenium are discussed. We suggest that attention should be paid to the vitamin A deficiency in erythrodermic or pustular psoriasis and to the vitamin E deficiency when these inflammatory diseases are associated with chronic alcoholism.

Alcoholism↗

PubMed1993

Cloning and sequence analysis of the gene encoding the crystalline surface layer protein of Rickettsia typhi.

The nucleotide sequence of the gene (slpT) encoding the crystalline surface layer protein (SLP) of Rickettsia typhi was determined. The slpT gene consists of 4935 bp coding for a 1645-amino-acid (aa) protein containing a predicted signal peptide at the N terminus. The size of the predicted SLP exceeds the observed size (135 kDa) on SDS-PAGE. The N-terminal aa sequence of the 32-kDa protein of R. typhi reported by Hackstadt et al. [Infect. Immun. 60 (1992) 159-165] was found in the C-terminal portion of the deduced aa sequence, suggesting that the product of slpT is processed into the mature SLP and the 32-kDa protein.

Amino Acid Sequence↗

PubMed1993

Radiological evaluation of pulmonary vein obstruction including two examinations by magnetic resonance imaging.

Congenital obstruction of the pulmonary vein without anomalous drainage can cause long-standing pulmonary congestion and pulmonary arterial hypertension, and it may include stenosis of individual pulmonary veins and pulmonary vein atresia. We reviewed seven cases of pulmonary vein obstruction, five of which were accompanied by other cardiac anomalies. Right pulmonary veins were involved in all seven cases; one case was bilateral. Pulmonary veins were occluded totally in five and partially in three lungs. Diagnostic pulmonary catheterization and angiography were performed. Chest radiographs of total occlusion cases showed decreased lung volume, features of pulmonary edema, interstitial lesions, and pleural changes, which were quite specific, whereas pulmonary venous dilatation was the dominant finding in partial obstruction cases. Pulmonary perfusion scan (n = 3) showed total perfusion defects in the cases with total occlusion of pulmonary veins. Magnetic resonance (MR) imaging (n = 2) demonstrated totally occluded pulmonary veins at the venoatrial junction in two lungs and membranous focal obstruction in one lung. Two children underwent pneumonectomy and had the diagnosis histologically confirmed. Although catheterization and angiography are essential for the diagnosis of pulmonary vein obstruction, MR imaging is a useful adjunct.

Adolescent↗

PubMed1993

Endodermal sinus tumour associated with benign teratoma of the common bile duct.

We report a 5-year-old boy with endodermal sinus tumour associated with benign cystic teratoma of the common bile duct (CBD). To our knowledge, there has been one case of teratoma of the CBD in the English literature with no morphological or radiological description. Our case presented a lobulated polypoid mass obstructing the distal CBD on sonography and computed tomography, which resembled the botryoid masses of rhabdomyosarcoma.

Child, Preschool↗

PubMed1993

Variations in iron-status measures during the menstrual cycle.

To determine whether normal physiologic changes associated with hormone fluctuations over the menstrual cycle affect concentrations of iron-status indicators, we examined data from 1712 women aged 18-44 y from the Second National Health and Nutrition Examination Survey (NHANES II) after adjusting for potential confounders. Adjusted mean values of hemoglobin (Hb), transferrin saturation (TS), and serum ferritin (SF) were lowest for women whose blood was drawn during menses and highest for women examined in luteal or late luteal phase of the menstrual cycle (Hb = 130 vs 133 g/L; TS = 21.2% vs 24.8%, P < 0.01 for both; and SF = 17.2 vs 24.0 micrograms/L, P < 0.05). The prevalence estimate of impaired iron status was significantly higher for women whose blood was drawn during the menstrual phase than for women whose blood was drawn during the luteal and late luteal phases. Our findings suggest that the phases of the menstrual cycle affect the concentration or values of iron-status indicators. These cyclic variations in indicators of iron status are a potential source of error when iron status is assessed in large population surveys that include women of reproductive age.

Adolescent↗

PubMed1993

Vitamin and mineral supplement use and mortality in a US cohort.

OBJECTIVES: Vitamin and mineral supplementation is a common practice in the United States, yet little is known about the long-term health effects of regular supplement use. METHODS: To examine the relationship between reported use of supplements and mortality, we analyzed data from US adults 25 to 74 years of age who were examined in the First National Health and Nutrition Examination Survey (1971 to 1975), with vital status determined through 1987. RESULTS: At baseline, 22.5% of the cohort reported using supplements regularly and 10.0% reported irregular use. The risk of mortality for regular supplement users was similar to that for nonusers. No consistent mortality benefits or risks of supplement use were found across a number of population subgroups. The risk for those who reported supplement use at both the baseline and a follow-up interview approximately 10 years later was similar to the risk for those who reported not using supplements at either interview. CONCLUSIONS: We found no evidence of increased longevity among vitamin and mineral supplement users in the United States. Considering the wide use of supplements in the general population, the cost-effectiveness and the safety of supplement use need to be better defined.

Adult↗

PubMed1993

Urinary epidermal growth factor in patients with gliomas: significance of the factor as a glial tumor marker.

Epidermal growth factor (EGF) content in urine from patients with glial tumors was examined by radioimmunoassay techniques with labeled human EGF and its rabbit EGF polyclonal antibody. There was no cross-reaction with transforming growth factor-alpha, which has a common receptor with EGF. Forty glial tumors were divided into three groups according to the clinical stage: Samples from Group A patients were obtained before therapy and/or after biopsy; in these patients a large volume of tumor was apparent on computerized tomography (CT). Group B samples were obtained after gross total removal of the tumor and/or chemo- and radiation therapy; these patients showed a small volume of residual tumor on CT. Samples from Group C patients were obtained after gross tumor total removal and/or chemo- and radiation therapy; no tumor was detected on CT scans in these patients. Urinary EGF levels in Group A samples were statistically significantly higher than in samples from healthy individuals (p < 0.001), Group B patients (p < 0.10), and Group C patients (p < 0.02). In addition, high-grade glial tumors in Group A cases showed a significantly higher level of urinary EGF than low-grade tumors in Group A patients (p < 0.05), or patients with meningioma (p < 0.02), metastatic brain tumor (p < 0.05), and cerebral infarction (p < 0.001). Longitudinal changes of urinary EGF levels in glioma patients mostly synchronized with the clinical course and therapeutic interventions. Therefore, urinary EGF, as a glial tumor marker, may be of practical value for diagnosing a malignant glioma and evaluating for the efficacy of chemo- and radiation therapy.

Adolescent↗