Search PubMed⌕ Search

Biomedical subjects

Hiroyuki Tanaka

Publications and source records attributed to Hiroyuki Tanaka.

At least 73 records · Page 4Linked to original sources
PubMed2005

Chaotropic ions and multivalent ions activate sperm in the viviparous fish guppy Poecilia reticulata.

The control system of sperm motility in the fishes with internal fertilization still remains to be studied. In the present study, we examined the sperm activation in the viviparous fish guppy Poecilia reticulata as a function of solute composition. The degree of sperm activation by inorganic and organic solutes correlated well with the lyotropic or Hofmeister series. The solutes that induced sperm activation corresponded to those that have been termed "chaotropes" or macromolecule-destabilizing solutes. In addition to this Hofmeister rule, multivalent cations and anions had valency-dependent activating effects at low concentrations. We investigated the cell signaling triggered by chaotropes and divalent cations and found an intracellular cAMP concentration increase upon the activation of sperm motility. From the present findings, we propose a novel regulation mechanism of sperm motility in the viviparous fish.

Animals↗
PubMed2005

Suppression of allergic inflammation by the prostaglandin E receptor subtype EP3.

Prostaglandins, including PGD(2) and PGE(2), are produced during allergic reactions. Although PGD(2) is an important mediator of allergic responses, aspirin-like drugs that inhibit prostaglandin synthesis are generally ineffective in allergic disorders, suggesting that another prostaglandin-mediated pathway prevents the development of allergic reactions. Here we show that such a pathway may be mediated by PGE(2) acting at the prostaglandin E receptor EP3. Mice lacking EP3 developed allergic inflammation that was much more pronounced than that in wild-type mice or mice deficient in other prostaglandin E receptor subtypes. Conversely, an EP3-selective agonist suppressed the inflammation. This suppression was effective when the agonist was administered 3 h after antigen challenge and was associated with inhibition of allergy-related gene expression. Thus, the PGE(2)-EP3 pathway is an important negative modulator of allergic reactions.

Allergens↗
PubMed2005

Functional importance of Ca2+-deficient N-terminal lobe of molluscan troponin C in troponin regulation.

Ca(2+)-binding sites I and II in the N-terminal lobe of molluscan troponin C (TnC) have lost the ability to bind Ca(2+) due to substitutions of the amino acid residues responsible for Ca(2+) liganding. To evaluate the functional importance of the Ca(2+)-deficient N-terminal lobe in the Ca(2+)-regulatory function of molluscan troponin, we constructed chimeric TnCs comprising the N-terminal lobes from rabbit fast muscle and squid mantle muscle TnCs and the C-terminal lobe from akazara scallop TnC, TnC(RA), and TnC(SA), respectively. We characterized their biochemical properties as compared with those of akazara scallop wild-type TnC (TnC(AA)). According to equilibrium dialysis using (45)Ca(2+), TnC(RA), and TnC(SA) bound stoichiometrically 3 mol Ca(2+)/mol and 1 mol Ca(2+)/mol, respectively, as expected from their primary structures. All the chimeric TnCs exhibited difference-UV-absorption spectra at around 280-290 nm upon Ca(2+) binding and formed stable complexes with akazara scallop troponin I, even in the presence of 6M urea, if Ca(2+) was present. However, when the troponin complexes were constructed from chimeric TnCs and akazara scallop troponin T and troponin I, they showed different Ca(2+)-regulation abilities from each other depending on the TnC species. Thus, the troponin containing TnC(SA) conferred as high a Ca(2+) sensitivity to Mg-ATPase activity of rabbit actomyosin-akazara scallop tropomyosin as did the troponin containing TnC(AA), whereas the troponin containing TnC(RA) conferred virtually no Ca(2+) sensitivity. Our findings indicate that the N-terminal lobe of molluscan TnC plays important roles in molluscan troponin regulation, despite its inability to bind Ca(2+).

Animals↗
PubMed2005

The nuclear factor HMGB1 mediates hepatic injury after murine liver ischemia-reperfusion.

High-mobility group box 1 (HMGB1) is a nuclear factor that is released extracellularly as a late mediator of lethality in sepsis as well as after necrotic, but not apoptotic, death. Here we demonstrate that in contrast to the delayed role of HMGB1 in the systemic inflammation of sepsis, HMGB1 acts as an early mediator of inflammation and organ damage in hepatic ischemia reperfusion (I/R) injury. HMGB1 levels were increased during liver I/R as early as 1 h after reperfusion and then increased in a time-dependent manner up to 24 h. Inhibition of HMGB1 activity with neutralizing antibody significantly decreased liver damage after I/R, whereas administration of recombinant HMGB1 worsened I/R injury. Treatment with neutralizing antibody was associated with less phosphorylation of c-Jun NH(2)-terminal kinase and higher nuclear factor-kappaB DNA binding in the liver after I/R. Toll-like receptor 4 (TLR4)-defective (C3H/Hej) mice exhibited less damage in the hepatic I/R model than did wild-type (C3H/HeOuj) mice. Anti-HMGB1 antibody failed to provide protection in C3H/Hej mice, but successfully reduced damage in C3H/Ouj mice. Together, these results demonstrate that HMGB1 is an early mediator of injury and inflammation in liver I/R and implicates TLR4 as one of the receptors that is involved in the process.

Animals↗
PubMed2005

Kampo Medicines for Mite Antigen-Induced Allergic Dermatitis in NC/Nga Mice.

We have established an allergic dermatitis model in NC/Nga mice by repeated local exposure of mite antigen for analyzing atopic dermatitis. We examined how four Kampo medicines, Juzen-taiho-to, Hochu-ekki-to, Shofu-san and Oren-gedoku-to, on the dermatitis model to obtain basic information on their usefulness for treating atopic dermatitis. Mite antigen (Dermatophagoides farinae crude extract) solution at a concentration of 10 mg/ml was painted on the ear of NC/Nga mice after tape stripping. The procedure was repeated five times, at 7 day intervals. An apparent biphasic ear swelling was caused after the fourth and fifth antigen exposures with elevated serum IgE levels and accumulation of inflammatory cells. In the cervical lymph nodes and ear lobes, the five procedures of antigen exposure induced interleukin-4 mRNA expression but reduced interferon-gamma mRNA expression. Oral administration of all four Kampo medicines inhibited the formation of ear swelling and inflammatory cell accumulation. Juzen-taiho-to and Hochu-ekki-to apparently prevented the elevation of serum IgE level. Furthermore, the four Kampo medicines showed a tendency to prevent not only the increase in interleukin-4 mRNA expression but also the decrease in interferon-gamma mRNA expression. The present results indicate that Juzen-taiho-to, Hochu-ekki-to, Shofu-san and Oren-gedoku-to may correct the Th1/Th2 balance skewed to Th2, and this activity helps inhibit dermatitis in NC/Nga mice. The ability of the Kampo medicines to correct the Th1/Th2 balance seems to underlie their effectiveness in treating of atopic dermatitis.

Journal Article↗
PubMed2005

Synthetic salusins as cardiac depressors in rat.

Using bioinformatic analyses of full-length, enriched human cDNA libraries, we recently identified salusins, multifunctional related peptides ubiquitously expressed in major human tissues. Salusins cause transient and profound hypotension when injected intravenously to rats, the hypotensive effect of salusin-beta being especially striking. However, the mechanisms of this hypotensive action remain elusive. To determine whether salusins modulate cardiac function in rats, we studied serial changes of systemic hemodynamics and functions of isolated perfused working and nonworking hearts before and after salusin administration. Intravenous salusin-beta administration to intact anesthetized rats caused a temporary rapid, profound decrease in aortic blood flow concomitantly with hypotension and bradycardia without affecting systemic vascular resistance. Salusin-beta-induced hypotension and bradycardia were completely blocked by pretreatment with atropine, a muscarinic receptor antagonist, but not by propranolol. In isolated perfused working rat hearts, salusin-beta significantly decreased cardiac output, aortic flow, and stroke work. However, it did not affect coronary flow in isolated working and nonworking hearts. Our results indicate that salusins induce potent hypotension via negative inotropic and chronotropic actions. Salusin-beta promotes its actions by facilitating vagal outflows to the heart, whereas the negative inotropism of salusin-beta is also mediated via a direct myotropic effect.

Adenosine Triphosphatases↗
PubMed2005

Gene transfer into adult rat spinal cord using naked plasmid DNA and ultrasound microbubbles.

BACKGROUND: Although gene therapy might become a promising approach to treat spinal cord injury, the safety issue is a serious consideration in human gene therapy. Plasmid DNA transfer is safer than viral vectors, but the transfection efficiency is quite low. To overcome the problem, we applied the ultrasound microbubbles-mediated transfection method to the spinal cord in adult rats, since ultrasound microbubbles have been reported to be efficient to increase transfection efficiency in various tissues. METHODS: After exposing T9-10 spinal cord with a laminectomy, we injected a mixture of naked plasmid DNA and microbubbles into cerebrospinal fluid by lumbar puncture. Then, the T9-10 spinal cord was exposed to ultrasound. CONCLUSIONS: An ultrasound intensity of 0.4-0.5 W/cm2 significantly increased luciferase expression up to approximately 15-60-fold at the insonated level as compared to naked plasmid DNA alone. Luciferase activity could be detected at least up to 7 days after transfection, while the expression level was almost returned to undetectable level at 14 days after transfection. The transfected cells were mainly meningeal cells in the surface of insonated spinal cord. There was no obvious evidence of worsening of neurological deficits as compared to rats transfected with naked plasmid DNA alone or untransfected rats. Similarly, successful gene transfer was also achieved in the insonated T9-10 spinal cord after spinal cord injury. Overall, the present study demonstrated the feasibility of ultrasound microbubbles-mediated plasmid DNA transfer into the target level of the spinal cord.

Animals↗
PubMed2005

Isolation of ginsenoside Rb1 from Kalopanax pictus by eastern blotting using anti-ginsenoside Rb1 monoclonal antibody.

Araliaceous species containing ginsenosides, the major active component in Panax species, were surveyed using ELISA and eastern blotting with anti-ginsenoside Rb1 monoclonal antibody. Immunoassay-guided fractionation of the methanol-soluble extracts of Araliaceous species led to the isolation of a known compound in the bark of Kalopanax pictus Nakai. The known compound was identified as ginsenoside Rb1 by spectroscopic methods and by comparison with an authentic sample. The result provided evidence that a combination of two immunoassays using monoclonal antibodies against ginsenosides is a powerful means of surveying new ginsenoside resources.

Antibodies, Monoclonal↗
PubMed2005

A whole-arm translocation (WAT8/9) separating Sumatran and Bornean agile gibbons, and its evolutionary features.

Gibbons, like orangutans, are a group of threatened Asian apes, so that genetic monitoring of each species or subspecies is a pressing need for conservation programmes. We conducted a project to take, as far as possible, samples of known origin from wild-born animals from Sumatra and Borneo (Central Kalimantan) for genetic monitoring of agile gibbons. As a result, we found a whole arm translocation between chromosomes 8 and 9 (WAT8/9) specific to Sumatran agile gibbons. Furthermore, population surveys suggested that the form with the WAT8/9 seems to be incompatible with an ancestral form, suggesting that the former might have extinguished the latter from Sumatran populations by competition. In any case, this translocation is a useful chromosomal marker for identifying Sumatran agile gibbons. Population genetic analyses with DNA showed that the molecular genetic distance between Sumatran and Bornean agile gibbons is the smallest, although the chromosomal difference is the largest. Thus, it is postulated that WAT8/9 occurred and fixed in a small population of Sumatra after migration and geographical isolation at the last glacial period, and afterwards dispersed rapidly to other populations in Sumatra as a result of the bottleneck effect and a chromosomal isolating mechanism.

Animals↗
PubMed2005

A novel glucosyltransferase involved in steroid saponin biosynthesis in Solanum aculeatissimum.

Steroidal saponins are widely distributed in many plant species. Their diverse structures have resulted in a wide range of applications, including drug and medicine production. It has been suggested that the nature of the non-saccharide and oligosaccharide portions of the saponin molecule both contribute to the properties of individual saponins. Despite numerous studies on the occurrence, chemical structure, and varying pharmaceutical activities of steroidal saponins, their biosynthesis pathway is poorly understood. Glycosylation is thought to be the final step in steroidal saponin biosynthesis and it is thought to be involved in regulating the biological activities of saponins. Isolation of the glycosyltransferases that catalyze the transfer of sugar molecules to steroidal compounds will help to clarify the mechanisms that produce diverse saponins and control their activities in plants. In this study, we obtained three cDNAs encoding putative glycosyltransferases from Solanum aculeatissimum. One of the three, SaGT4A showed UDP-glucosyltransferase activity. This is the first cloned glucosyltransferase involved in steroidal saponin biosynthesis. SaGT4A catalyzes the 3-O-glucosylation of steroidal sapogenins, such as diosgenin, nuatigenin, and tigogenin. This enzyme also glucosylates steroidal alkaloids, such as solanidine, solasodine, and tomatidine. Gene expression analysis revealed that the accumulation of SaGT4A transcripts showed a unique response to wounding stress indicating the involvement of SaGT4A in plant defense system.

Amino Acid Sequence↗
PubMed2005

Oral cibenzoline reduces postoperative atrial fibrillation in coronary artery bypass grafting.

OBJECTIVE: The objective of the present study was to investigate the effectiveness of postoperative oral administration of cibenzoline for the prevention of atrial fibrillation (AF) in coronary artery bypass grafting (CABG). METHODS: A total of 39 patients who underwent isolated CABG from September 2000 to February 2001 and who took oral cibenzoline (300 mg per day for 10 days beginning immediately after surgery) were compared to 59 patients who underwent surgery in our department 8 months prior to the study and who did not take cibenzoline for incidence of postoperative AF. Exclusion criteria encompassed age (>80 years), low ejection fraction (<30%), high serum creatinine level (>2.0 mg/dL), and history of supraventricular arrhythmia with or without treatment by anti-arrhythmic drugs. RESULTS: Postoperative AF occurred in 2 patients in the cibenzoline group (2/35, 5.7%) and 20 patients in the control group (20/59, 33.9%). There were significant differences in the incidence of postoperative AF (p = 0.002). Multivariate analysis revealed that the administration of cibenzoline reduced the incidence of AF significantly, and that a large number of bypass grafts significantly contributed to postoperative AF in CABG. The number of bypass grafts was significantly larger in the cibenzoline group, indicating that cibenzoline administration significantly suppresses the incidence of AF after CABG in high-risk patients. CONCLUSIONS: Postoperative administration of oral cibenzoline for 10 days is one effective method for the prevention of AF after CABG.

Administration, Oral↗
PubMed2005

Safe coronary artery occlusion with a new tourniquet in off-pump bypass grafting.

Coronary artery occlusion during off-pump coronary artery bypass grafting may lead to mechanical trauma of the arterial wall. My colleagues and I describe a safe coronary artery occlusion technique in off-pump bypass grafting that uses a new spring-equipped tourniquet, which enables precise adjustment of the least force necessary to occlude the coronary flow. This prevents snare-induced vessel wall damage.

Coronary Artery Bypass, Off-Pump↗
PubMed2005

Effects of the postoperative administration of diltiazem on renal function after coronary artery bypass grafting.

BACKGROUND: Radial artery grafts are used for coronary artery bypass grafting (CABG), and postoperative antispasm therapy with diltiazem is performed widely. Some investigators have warned that diltiazem administration after cardiac surgery is harmful to renal function. We designed a retrospective study to investigate the renal and hemodynamic effects of the postoperative administration of diltiazem in patients undergoing CABG. METHODS: Subjects were 90 consecutive CABG patients. All were treated with diltiazem during surgery (a 0.1 mg/kg bolus injection followed by continuous infusion at 2 microg x kg(-1) x min(-1)). In the 50 patients (diltiazem group) with a radial artery graft, intravenous diltiazem administration was continued until the oral intake of diltiazem (90 mg/d) was begun to avoid graft spasms. In the remaining 40 patients without a radial artery graft, diltiazem was not continued postoperatively (control group). Postoperative renal function, assessed by serum creatinine level and creatinine clearance, and hemodynamic variables (heart rate, arterial pressure, pulmonary wedge pressure, cardiac index, left ventricular stroke work index) was compared between the two groups. RESULTS: Renal function: Serum creatinine concentrations on postoperative days 1 through 7 were lower, and the endogenous creatinine clearance in the early postoperative period was higher in diltiazem group than in control group, although the differences were not significant. Hemodynamics: Heart rate was lower in diltiazem group than in the control group, but blood pressure, pulmonary wedge pressure, cardiac index, left ventricular stroke work index, and urinary output were similar between the groups. CONCLUSIONS: Our results confirmed that intravenous diltiazem treatment in patients undergoing CABG is not harmful to renal function.

Coronary Artery Bypass↗
PubMed2005

An effective case of growth hormone treatment on cartilage-hair hypoplasia.

Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.

Body Height↗
PubMed2005

Aprotinin attenuated ischemia-reperfusion injury in an isolated rat lung model after 18-hours preservation.

OBJECTIVE: Ischemia-reperfusion injury is a major factor in the early phase of lung transplantation. We hypothesized that aprotinin, a nonspecific serine protease inhibitor, attenuates ischemia-reperfusion lung injury by inhibiting the inflammatory response and suppressing NADPH oxidase. METHODS: We used an isolated rat lung model to test the above. A Control group was immediately perfused with fresh heparinized allogeneic blood after lung harvest without an ischemic period. Study lungs were flushed with low-potassium dextran (LPD) solution and stored for 18h at 4 degrees C then divided into two groups: the LPD group was flushed with LPD solution only, and the LPD+A group was flushed with LPD solution +200KIU/ml aprotinin. Lungs in all three groups were then reperfused with fresh heparinized allogeneic blood for 120min at 37 degrees C. RESULTS: Throughout reperfusion, PO(2) levels in the LPD+A group were similar to those in the Control group; although in the LPD group, PO(2) levels were significantly lower (P<0.05). Tissue MDA levels were significantly higher in the LPD group than the Control and LPD+A groups (P<0.05). IL-8 levels were significantly higher in the LPD group than the Control group (P<0.05), while in the LPD+A group they were similar to those in the Control group. Histological evaluation showed interstitial edema accompanied by neutrophil extravasation in the LPD group, whereas this effect was modest in the LPD+A group. An additional study of ischemia-reperfusion in an alveolar macrophage culture showed that the activitvation of NADPH oxidase, and translocation of p47(phox) from the cytosol to the membrane were suppressed in aprotinin group. CONCLUSIONS: Aprotinin attenuates ischemia-reperfusion lung injury by inhibiting the early inflammatory response, neutrophil extravasation and the production of oxygen free radicals through inhibition of the activation of the NADPH oxidase. The inhibition of p47(phox) translocation in alveolar macrophage seemed involved in this mechanism of aprotinin.

Animals↗
PubMed2005

Global pollution monitoring of polychlorinated dibenzo-p-dioxins (PCDDs), furans (PCDFs) and coplanar polychlorinated biphenyls (coplanar PCBs) using skipjack tuna as bioindicator.

In order to elucidate the global distribution of dioxins and related compounds, such as PCDDs, PCDFs and coplanar PCBs, levels of these compounds were determined in the muscle of skipjack tuna (Katsuwonus pelamis) collected from the offshore waters and open seas near Japan, Taiwan, Philippines, Indonesia, Seychelles and Brazil, and the Japan Sea, the East China Sea, the South China Sea, the Indian Ocean and the North Pacific Ocean. PCDDs, PCDFs and coplanar PCBs were detected in almost all the specimens collected from all the locations surveyed, indicating widespread contamination by these compounds in the marine environment. Higher concentrations of dioxins and coplanar PCBs were detected in the samples from temperate Asian regions, plausibly due to larger usage and anthropogenic generation in highly industrialized countries around the East China Sea and the South China Sea, such as Japan, Korea, Taiwan, Hong Kong and coastal China.

Animals↗
PubMed2005

Native polysomes of Saccharomyces cerevisiae in liquid solution observed by atomic force microscopy.

The native polysomes of Saccharomyces cerevisiae were visualized in liquid solution by atomic force microscopy without external contrasting, such as shadowing and negative staining. This study showed native polysomes as lined particle with a height of ca. 27 nm, which is agreement with the height of 80S ribosomes in previous study. We found a small subparticle, located in a ring-shape or at the end of a linear structure, and visualized mRNA chains between adjacent ribosomes. Although the structures of polysomes have been studied for decades, it has remained difficult to visualize the native three-dimensional form. By the observation in liquid solution, we temporarily stopped the translation using an antibiotic to presenting the native three-dimensional structure and function of the polysomes. Our results provide not only new findings on native eukaryotic polysomes, but also great potential to visualize the influence of various environmental conditions on polysomes.

Microscopy, Atomic Force↗