Biomedical subjects

Hiroshi Ishii

Publications and source records attributed to Hiroshi Ishii.

At least 19 recordsLinked to original sources

PubMed2007

Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism.

PURPOSE: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities. PATIENTS AND METHODS: Genotyping of CDA was performed by a direct sequencing of DNA obtained from the peripheral blood of Japanese gemcitabine-naïve cancer patients (n = 256). The patients recruited to the association study received a 30-minute intravenous infusion of gemcitabine at a dose of either 800 or 1,000 mg/m2, and eight blood samples were periodically collected (n = 250). Plasma levels of gemcitabine and dFdU were measured by high-performance liquid chromatography. Plasma CDA activities toward cytidine and gemcitabine were also measured (n = 121). RESULTS: Twenty-six genetic variations, including 14 novel ones and two known nonsynonymous single nucleotide polymorphisms (SNPs), were detected. Haplotypes harboring the nonsynonymous SNPs 79A>C (Lys27Gln) and 208G>A (Ala70Thr) were designated *2 and *3, respectively. The allelic frequencies of the two SNPs were 0.207 and 0.037, respectively. Pharmacokinetic parameters of gemcitabine and plasma CDA activities significantly depended on the number of haplotype *3. Haplotype *3 was also associated with increased incidences of grade 3 or higher neutropenia in the patients who were coadministered fluorouracil, cisplatin, or carboplatin. Haplotype *2 showed no significant effect on gemcitabine pharmacokinetics. CONCLUSION: Haplotype *3 harboring a nonsynonymous SNP, 208G>A (Ala70Thr), decreased clearance of gemcitabine, and increased incidences of neutropenia when patients were coadministered platinum-containing drugs or fluorouracil.

Adult↗

PubMed2007

The prophylactic effectiveness of various antifungal agents against the progression of trichosporonosis fungemia to disseminated disease in a neutropenic mouse model.

Neutropenic mice with latent trichosporonemia were given various antifungal agents (amphotericin B, fluconazole, itraconazole) or saline to determine which antifungal agent could be useful for prophylaxis. The 3-week-survival rate was 80% in the fluconazole group, 50% in the amphotericin B group, 45% in the itraconazole group, and 30% in the saline group. Compared with the other antifungal agents, fluconazole offered superior prophylaxis against the progression of trichosporonosis fungemia to disseminated disease (P<0.05). These results suggest that clinical studies are warranted to investigate fluconazole prophylaxis of trichosporonosis progression in neutropenic patients, such as people receiving chemotherapy and patients who have received solid organ transplants.

Amphotericin B↗

PubMed2006

Elevated BALF concentrations of alpha- and beta-defensins in patients with pulmonary alveolar proteinosis.

Defensins are endogenous antibiotics and regulators of inflammation, immunity and wound repair. Their concentrations are substantially increased in bronchoalveolar lavage fluid (BALF) of patients with infectious lung diseases. alpha-defensin (HAD) levels are also elevated in patients with idiopathic pulmonary fibrosis (IPF) and correlated with the decline in pulmonary function tests, suggesting the association of defensins with the pathogenesis of interstitial lung diseases. The aim of this study was to determine the profile of defensins in interstitial lung diseases. Serum and BALF levels of HAD and beta-defensin 1 and 2 (HBD-1, and -2) were measured by radioimmunoassay in 63 patients with interstitial lung diseases, including idiopathic pulmonary alveolar proteinosis (PAP), IPF, nonspecific interstitial pneumonia (NSIP), cryptogenic organizing pneumonia (COP) and pulmonary sarcoidosis, and in 9 healthy volunteers as controls. Levels of HAD in BALF of patients with PAP were significantly higher than those in controls and patients with COP and sarcoidosis. Serum levels of HAD in all groups were significantly higher than those in controls. Levels of HBD-1 and -2 in BALF of patients with PAP were extremely high in all subjects. Serum levels of HBD-1 were higher in all patient groups, with the exception of those with PAP, and those of HBD-2 were also higher in patients with IPF and sarcoidosis, compared with controls. BALF of PAP patients, but not IPF patients and controls, expressed antimicrobial activity against Pseudomonas aeruginosa and Staphylococcus aureus. Our findings suggest different kinetics of HAD and HBD-1 and -2 in serum and BALF of interstitial lung diseases and that these antimicrobial peptides in the airway lumen may contribute to prevention of bacterial airway infections in PAP.

Adult↗

PubMed2006

Early phase II study of uracil-tegafur plus doxorubicin in patients with unresectable advanced biliary tract cancer.

BACKGROUND: Standard chemotherapy for advanced biliary tract cancer has not been established. The purpose of this study was to evaluate the efficacy and toxicity of a combination chemotherapy of uracil-tegafur (UFT) and doxorubicin in patients with unresectable advanced biliary tract cancer. METHODS: Patients with histologically or cytologically confirmed, measurable biliary tract cancer, including intrahepatic or extrahepatic cholangiocarcinoma, gallbladder cancer and ampulla of Vater cancer, which was not amenable to surgery, were eligible for the study. Patients received oral UFT 300 mg/m(2) per day divided into two doses on Days 1-14 and intravenous doxorubicin 30 mg/m(2) on Day 1. This cycle was repeated every 21 days. Additional courses of this regimen were given until a maximum of 15 courses, disease progression or the appearance of unacceptable toxicity. RESULTS: Twenty-four patients from five institutions were enrolled between March 2004 and November 2004. Of the 24 patients, three had partial responses for an objective response rate of 12.5% (95% confidence interval, 2.7-32.4%), 13 patients had stable disease, 7 had progressive disease and the final patient was not evaluated. Grade 3 toxicity was observed in 5 of the 24 patients (20.8%), and these toxicities included anorexia, fatigue, anemia and neutropenia. None had grade 4 toxicity. The median progression-free and overall survival time was 2.5 and 7.6 months, respectively. CONCLUSIONS: Combination chemotherapy of UFT and doxorubicin was well tolerated and showed preliminary moderate activity against advanced biliary tract cancer. Further investigation in a late phase II study involving a large number of patients is recommended.

Aged↗

PubMed2006

A phase I/II study of combination chemotherapy with gemcitabine and 5-fluorouracil for advanced pancreatic cancer.

BACKGROUND: In an effort to improve efficacy of single-agent gemcitabine in pancreatic cancer, several studies have examined the effects of 5-FU combined with gemcitabine. However, no studies to date have been performed in Japanese patients. We thus conducted a phase I/II study of gemcitabine and infusional 5-FU in Japanese patients to determine a recommended dosage for this combination and clarify efficacy and toxicity. METHODS: Phase I evaluated the frequency of dose limiting toxicity of two 5-FU dosages (400 and 500 mg/m(2)/day) infused continuously over 5 days combined with gemcitabine 1000 mg/m(2) x 3 every 4 weeks. Results from phase I determined the recommended dosage to be examined in phase II for effect on survival period, clinical benefit response (CBR), tumor response and safety. RESULTS: A total of 34 chemo-naive patients were entered into the study. All had a Karnofsky performance of > or =50 points and distant metastases. Dose limiting toxicities in phase I determined the recommended 5-FU dosage at 400 mg/m(2)/day. Grade 3-4 hematological toxicities (neutropenia, leukopenia and thrombocytopenia) were the most common severe toxicities. For the 28 patients administered the recommended dosage, 1-year survival rate was 14.3%, median survival time 7.1 months and progression free survival 3.2 months. Seven patients achieved a 25% overall response rate and three showed 27.3% improvement in CBR. CONCLUSION: Although a meaningful survival benefit over single-agent gemcitabine was not demonstrated, 5-FU 400 mg/m(2)/day infused continuously over 5 days in combination with gemcitabine 1000 mg/m(2) x 3 every 4 weeks appeared to be a moderately effective palliative treatment with low toxicity in Japanese patients with metastatic pancreatic cancer.

Adult↗

PubMed2006

A phase II study of weekly irinotecan as first-line therapy for patients with metastatic pancreatic cancer.

PURPOSE: The aim of this study was to assess the efficacy and toxicity of weekly irinotecan in patients with metastatic pancreatic cancer. PATIENTS AND METHODS: Patients with histologically proven pancreatic adenocarcinoma, at least one bidimensionally measurable metastatic lesion, and no prior chemotherapy were selected. Irinotecan at a dose of 100 mg/m2 was administered intravenously for 90 min on days 1, 8, and 15 every 4 weeks until disease progression or unacceptable toxicity. Pharmacokinetics was examined on day 1 of the first cycle of treatment. RESULTS: Thirty-seven of 40 enrolled patients were assessable for efficacy and toxicity. A partial response was obtained in 10 patients, giving an overall response rate of 27.0% (95% confidence interval 13.8-44.1%). The median overall survival was 7.3 months with a 1-year survival rate of 29.5%. Although toxicities were generally tolerated, one patient died of disseminated intravascular coagulation syndrome induced by neutropenia with watery diarrhea. Pharmacokinetic study showed that patients with biliary drainage seemed to have higher area under the concentration versus time curve for irinotecan and its metabolites compared with patients without biliary drainage. CONCLUSION: Single-agent irinotecan has significant efficacy for metastatic pancreatic cancer. The toxicity with this schedule appears manageable, though it must be monitored carefully.

Adult↗

PubMed2006

Pulmonary adenocarcinoma associated with SAPHO syndrome difficult to differentiate from multiple bone metastasis.

The patient was a 57-year-old man with a chief complaint of anterior chest pain who was diagnosed with clinical stage IV (c-T2N2M1) non-small-cell lung cancer (adenocarcinoma). Tenderness in the sternoclavicular joint, acne, periodontitis, and palmoplantar pustulosis were evident, and SAPHO syndrome was diagnosed. SAPHO syndrome is a rare disorder that results in synovitis, acne, pustulosis, hyperostosis, and osteomyelitis. Bone scintigraphy showed tracer accumulation in the costal cartilage, sternoclavicular joint, and cervical vertebrae 6-7. Although the bone lesions of SAPHO syndrome were difficult to differentiate from bone metastasis of pulmonary adenocarcinoma, metastatic bone tumors were ruled out by magnetic resonance imaging, computed tomography, and fluorodeoxyglucose positron emission tomography. There have been no previously reported cases of lung cancer with comorbid SAPHO syndrome. We report such a case and discuss the relevant literature, particularly that concerned with the evaluation of bone lesions.

Acquired Hyperostosis Syndrome↗

PubMed2006

New indication for reduction surgery in patients with advanced hepatocellular carcinoma with major vascular involvement.

BACKGROUND: The prognosis of advanced hepatocellular carcinoma (HCC) remains poor, particularly in patients with tumor thrombi (TT) in the major vessels. PATIENTS AND METHODS: From July 1992 to October 2004, 161 patients diagnosed as having advanced HCC with major vascular involvement were seen consecutively at our hospital. Among these patients, 32 (20%) underwent surgical resection [16 complete resection (CR), 16 reductive resection (RR)]. Eighteen patients (11%) received radiotherapy (RT), 73 (45%) underwent transcatheter arterial chemoembolization (TACE) or transcatheter arterial infusion chemotherapy (TAI), 8 (5%) with distant metastases received systemic chemotherapy, and 30 (19%) received palliative therapy. RESULTS: Excluding the CR group, the patients in the RR group had a higher 1-year survival rate than the other treatment groups. However, there was no significant difference in the overall survival rates of the RR, RT, and TACE/TAI groups. When we evaluated prognostic factors to clarify the indications for RR in the multidisciplinary treatment of patients with advanced HCC with TT, prothrombin activity (PA) was identified as a significant independent preoperative factor for overall survival in the RR group. The survival rate in patients with PA of < or = 78% was significantly lower than that of patients with PA of > 78% (P = 0.0004). The median survival time of patients with serum PA of > 78% who underwent RR was 13.9 months and that of patients who underwent CR was 9.1 months, with no survival difference between the groups. CONCLUSION: In advanced HCC with major vascular involvement, patients who had RR with PA of greater 78% achieved a similar survival to those who had CR. The surgeon should still proceed with RR in those patients with serum PA of > 78% if CR does not seem feasible on preoperative evaluation.

Carcinoma, Hepatocellular↗

PubMed2006

Effect of age and education on the Trail Making Test and determination of normative data for Japanese elderly people: the Tajiri Project.

The Trail Making Test (TMT) is a common two-part neuropsychological test, in which visuospatial ability (TMT-A) and executive function (TMT-B) are evaluated. Normative data for this test have not been reported for Japanese subjects; therefore, the purpose of the present paper was to investigate the effect of age and education on the TMT in 155 healthy elderly adults with clinical dementia rating 0 (healthy). The participants were classified into three groups based on age (70-74 years, 75-84 years and >or=85 years), and also into three groups based on educational level (6 years, 8 years and >or=10 years). The time to complete TMT-A and TMT-B were measured, and the difference in score between TMT-A and TMT-B (B-A) and the ratio of the score (B/A) were calculated as indices of executive function. The time for completion of both parts of the TMT increased markedly in the >or=85-years group. For TMT-A, there was a significant difference between the 6-years and 8-years groups, and between the 6-years and >or=10-years groups, and for TMT-B, there was a significant difference between the 6-years and >or=10-years groups, and between the 8-years and >or=10-years groups. The difference and ratio scores increased in the >or=85-years group, but the educational level did not significantly influence these scores. Our data suggest that cognitive functions evaluated by TMT-A and TMT-B are not affected by aging until the subjects are >or=85 years old. For TMT-A, an educational effect becomes apparent when the population includes poorly educated subjects, but this part of the test is not affected by educational level provided that the subjects have some education (>6 years). The time to complete TMT-B is affected by educational level, consistent with previous reports. However, when adjusted using the results for TMT-A [(B-A) or (B/A)], the educational effect on executive function disappeared. Thus, the effect of educational level on executive function was unclear in normal elderly subjects.

Aged↗

PubMed2006

Interstitial pneumonia caused by inhalation of fumes of nickel and chrome.

Two male industrial painters were admitted to hospital with dry cough and dyspnoea on exertion following a tank coating operation using a high-temperature spray paint consisting of a nickel-chromium alloy. Both patients showed hypoxaemia, peripheral leukocytosis, high levels of serum cytokines and bilateral ground-glass opacities on a chest CT scan. They were diagnosed with interstitial pneumonia caused by inhalation of nickel and chrome fumes and successfully treated with corticosteroid. These are rare cases of interstitial pneumonia associated with nickel/chromium inhalation.

Adrenal Cortex Hormones↗

PubMed2006

Elevated levels of interferon gamma-inducible protein-10 and epithelial neutrophil-activating peptide-78 in patients with pulmonary sarcoidosis.

OBJECTIVE AND BACKGROUND: Interferon gamma-inducible protein (IP)-10 and epithelial neutrophil-activating peptide (ENA)-78 belong to the CXC chemokine family and are important factors in inflammatory lung diseases. In sarcoidosis, the potential role of IP-10 to regulate the migration and activation of T-cells towards sites of sarcoid activity has been suggested. METHODS: In this study, the concentrations of IP-10 and ENA-78 in the serum and BAL fluid of patients with different stages of active pulmonary sarcoidosis (n=41) and healthy subjects (n=12) were measured by enzyme-linked immunosorbent assay to evaluate the contribution of these CXC chemokines to this disease. RESULTS: Serum and BAL fluid concentrations of IP-10 and BAL fluid levels of ENA-78 in patients with sarcoidosis were significantly higher than those in control subjects. The serum levels of IP-10 were significantly increased only in patients with stages I and II sarcoidosis, while BAL fluid levels of ENA-78 were increased only in stage III sarcoidosis. In addition, serum concentrations of IP-10 were elevated in patients with extrapulmonary lesions compared with those without such lesions. In patients with sarcoidosis, IP-10 concentrations in BAL fluid correlated with lymphocyte proportions in BAL fluid. CONCLUSION: IP-10 may play an important role in regulating lymphocytes into the lung and that ENA-78 may be associated with lung parenchymal disease in pulmonary sarcoidosis.

Adult↗

PubMed2006

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

5' Flanking Region↗

PubMed2006

[A case of multiple pulmonary arteriovenous fistulae associated with hereditary hemorrhagic telangiectasia that deteriorated during pregnancy].

A 29-year-old woman was admitted to our hospital because of persistent breathlessness on exertion after the delivery of her second child. Although at the age of 26 she had been given a diagnosis of multiple pulmonary arteriovenous fistula (PAVF), treatment was not done because of the absence of symptoms. An intrauterine growth retardation (IUGR) due to hypoxemia occurred during the second pregnancy, and then she delivered a 1,283g baby by cesarean section in the 36th gestation week. Her symptoms and hypoxemia improved after transcatheter embolization. Hereditary hemorrhagic telangiectasia was diagnosed on the basis of recurrent epistaxis since her childhood, pulmonary and hepatic vascular abnormality (PAVF and hepatic arterioportal shunt) and telangiectasis of the buccal mucosa and tongue. We should consider an early treatment of PAVF for young female because pregnancy may induce increase of arteriovenous shunt, fatal hemoptysis, infertility, miscarriage and IUGR.

Adult↗

PubMed2006

[Three cases of chronic bird fancier's lung associated with the use of feather bedclothes].

We report here 3 cases of chronic bird fancier's lung diagnosed immunologically using antibodies to pigeon dropping extract. None of the patients were bird fanciers but had indirect exposure to birds in their living environment, and had been using feather-filled duvets or pillows for a long time. Two of 3 cases were positive for environmental provocation tests and 2 cases had pathological findings of hypersensitivity pneumonitis such as multinucleated giant cells and non-necrotizing epithelioid cell granulomas. One case was resistant to steroid therapy alone and was successfully treated by coadministration of prednisolone and cyclosporin A. Another case was treated by steroid alone but died of acute exacerbation of unknown cause. These cases suggest that not only feathers but two or more kinds of bird-related antigens were involved in the sensitization immunology and development of bird fancier's disease, and that clinicians should perform thorough history taking with environmental surveillance relevant to birds.

Aged↗

PubMed2006

[A case of rheumatoid lung complicated by SELAPINA-induced pneumonia].

SELAPINA is generic product of PL granule which is one of the most common forms of combination remedies for the common cold in Japan, and includes acetaminophen. We report a case of SELAPINA-induced pneumonia successfully treated with glucocorticoid pulse therapy followed by orally administered prednisolone. A 68-year-old woman, who had been treated for rheumatoid arthiritis with pulmonary involvement, took SELAPINA with an antibiotic for 6 days because of her cold symptoms. She then suffered a high fever, cough, dyspnea, vomiting and diarrhea. Chest radiograph and high-resolution computed tomography (HRCT) scan revealed diffuse interstitial shadows. SELAPINA-induced pneumonia was diagnosed because the blastoid transformation test using her peripheral blood lymphocytes was positive on stimulation with SELAPINA, but negative for other medicines.

Acetaminophen↗

PubMed2005

A phase I study of combination chemotherapy with gemcitabine and oral S-1 for advanced pancreatic cancer.

OBJECTIVE: The aim of this study was to determine the maximum-tolerated dose and dose-limiting toxicity (DLT) of combination therapy with gemcitabine and S-1 in patients with advanced pancreatic cancer. METHODS: Chemotherapy-naive patients with histologically or cytologically proven unresectable or metastatic pancreatic cancer were enrolled. The patients received gemcitabine intravenously over 30 min on days 1 and 8 and S-1 orally twice daily from days 1 to 14. Cycles were repeated every 21 days until disease progression. Patients were scheduled to receive gemcitabine (mg/m(2)/week) and S-1 (mg/m(2)/day) at four dose levels: 800/60 (level 1), 1,000/60 (level 2), 1,000/70 (level 3) and 1,000/80 (level 4). RESULTS: Eighteen patients were enrolled in this study. The maximum-tolerated dose was not reached even at the highest dose level (level 4) because only 2 of the 6 patients at this level experienced DLT. The DLTs were neutropenia and rash. Six (33%) of the 18 patients achieved a partial response and median overall survival time was 7.6 months. CONCLUSIONS: Combination chemotherapy with gemcitabine and S-1 was well tolerated and showed good antitumor activity in the treatment of pancreatic cancer. We recommend a gemcitabine dose of 1,000 mg/m(2)/week and an S-1 dose of 80 mg/m(2)/day in further studies with this schedule.

Adult↗

PubMed2005

Phase I study of fixed dose rate infusion of gemcitabine in patients with unresectable pancreatic cancer.

OBJECTIVE: The purpose of this study was to determine the feasible dose of gemcitabine when administered as a fixed dose rate infusion (10 mg/m(2)/min) on a weekly schedule to Japanese patients with unresectable advanced pancreatic cancer. METHODS: Patients were required to have histologically or cytologically proven locally advanced or metastatic pancreatic cancer for which they had received no previous chemotherapy. Gemcitabine was administered intravenously weekly for three consecutive weeks every 4 weeks. Patients at three dose levels were scheduled to receive escalating doses of gemcitabine: 1000 mg/m(2) over 100 min (Level 1), 1200 mg/m(2) over 120 min (Level 2) and 1500 mg/m(2) over 150 min (Level 3). RESULTS: A total of 16 patients were enrolled in this study between December 2003 and September 2004. Maximum-tolerated dose was not reached during the first course. Dose-limiting toxicity was Grade 4 neutropenia. Grade 3 or 4 neutropenia was observed at Level 3 in all six patients in the first course, and administration of gemcitabine on Day 8 or 15 was skipped in all six patients. Non-hematologic toxicity was mild and the most common symptoms were anorexia, nausea and vomiting. Partial response was achieved in 1 of the 17 patients (7%). Median overall survival was 7.3 months. CONCLUSIONS: Gemcitabine administered at a rate of 10 mg/m(2)/min was tolerated up to 1500 mg/m(2), but 1200 mg/m(2) represented a more appropriate recommended dose in further studies owing to neutropenia in Japanese patients with advanced pancreatic cancer.

Aged↗

PubMed2005

Primary tumor of pancreatic cancer as a measurable target lesion in chemotherapy trials.

BACKGROUND: It is unclear whether primary pancreatic cancer (PC) tumors can be accepted as measurable target lesions in chemotherapy trials. We reviewed recent PC patients to clarify the significance of their computed tomography (CT) responses of the primary tumor after chemotherapy. METHODS: The patient selection criteria were (i) having been admitted between January 2002 and December 2004, (ii) diagnosed as having histologically or cytologically proven adenocarcinoma of the pancreas, (iii) treated with chemotherapy with no previous anticancer treatment and (iv) having been evaluated by follow-up CT to assess the response according to the Response Evaluation Criteria in Solid Tumors criteria. RESULTS: A total of 143 patients met the selection criteria. It was possible to measure the largest diameter of the primary tumor in 119 (83%) of the 143, and primary tumor shrinkage was observed in 10 (8%) of the 119. When regarding the primary as measurable as opposed to non-measurable, the number of patients with measurable disease became 127 from 67, and the frequencies of partial response (PR), stable disease (SD) and progressive disease (PD) became 11, 74 and 15% of the 127 from 18, 52 and 30% of the 67, respectively. In the former situation, large primary tumor sometimes canceled the shrinkage or progression of small metastasis. In each setting, PR or SD represented a favorable prognosis compared with PD, however, there were no statistical differences between the PR and the SD. CONCLUSION: Measuring the primary tumor is acceptable in approximately 80% of PC patients. However, we must be aware that the frequency of SD may increase compared with the PR or PD.

Adenocarcinoma↗