Preparation and combining site characterization of mouse monoclonal anti-B blood group substances.
Explore the source record for details and available documents.
ABO Blood-Group System↗
Biomedical subjects
H T Chen
Publications and source records attributed to H T Chen.
Cloning and characterization of the carp prolactin gene.
A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.
Amino Acid Sequence↗
Spontaneous bacterial peritonitis in patients with hepatitis B-related cirrhosis and hepatocellular carcinoma.
To delineate the natural clinical course of spontaneous bacterial peritonitis in hepatitis B-related cirrhosis and to determine if it occurs in hepatocellular carcinoma, a prospective survey was conducted in 262 patients over 2 1/2 years. The in-hospital incidence and mortality rates of spontaneous bacterial peritonitis were 21.6% and 36.4%, respectively, in cirrhosis and 7.3% and 50% in hepatocellular carcinoma. In cirrhosis, the cumulative probability of annual recurrence of spontaneous bacterial peritonitis was 47.3%, which was significantly higher than the annual probability of occurrence of 11.3% in those with no previous attack (P less than 0.0001). The cumulative probability of annual survival was 27.6% in the spontaneous bacterial peritonitis patients, significantly lower than the probability of 64.0% in the control group (P = 0.0001). A univariate analysis, with Kaplan-Meier curves compared by the Mantel-Cox test, and subsequent multivariate analysis by stepwise Cox regression procedure were used to evaluate 37 variables recorded immediately after admission. Blood urea nitrogen concentration greater than 10.5 mmol/L urea (greater than 30 mg/dL) and ascitic fluid protein concentration less than 7.35 g/L (less than 735 mg/dL) were found to be the only significant predictors of lower annual survival; ascitic fluid protein concentration less than 7.50 g/L (less than 750 mg/dL) was the only significant predictor of higher annual recurrence. The authors conclude that spontaneous bacterial peritonitis has a high risk of recurrence in hepatitis B-related cirrhosis and that the same disease occurring in patients with hepatocellular carcinoma is related to the underlying cirrhosis rather than the hepatocellular carcinoma.
Adult↗
3H-paroxetine binding in brains of alcoholics.
High affinity 3H-paroxetine binding was studied in human frontal cortex and hippocampus obtained from normal controls and alcoholics. On the basis of Scatchard analyses, a significant decrease in the maximal number of binding sites (Bmax) was found in the hippocampus of alcoholics (n = 8) as compared with that of controls (n = 10) (mean +/- SD = 63 +/- 35 vs. 114 +/- 70 fmoles/mg protein). There was no significant difference in the dissociation constants (Kd) between the two groups. The presumed effect of chronic alcohol abuse on 3H-paroxetine binding may be region-specific since no significant difference in either Bmax or Kd for 3H-paroxetine binding was found in the frontal cortex between normal controls and alcoholics. No significant correlation of 3H-paroxetine binding with age or postmortem interval was observed. The decrease in 3H-paroxetine binding in the hippocampus of alcoholics is probably indicative of reduced density of serotonergic nerve terminals either as a preexisting condition or as a result of neuronal damage caused by ethanol or the sequelae of alcoholism, such as nutritional deficiencies.
Adult↗
[Synthesis and antiinflammatory and anticancer activities of 2-(E)-(un)substituted benzylidene cyclopentanones and their Mannich base hydro chlorides].
It has been known that non-steroidal antiinflammatory drugs (NSAIDs) act by preventing cyclooxygenase products of arachidonic acid. In recent years, research on non-steroid dual inhibitors of cyclooxygenase (CO) and 5-lipoxygenase (5-LO), which should represent a novel class of antiinflammatory drugs with a wider spectrum of activity than classical NSAIDs, has been carried out. In the present paper, a total of 29 compounds including 18 compounds of 2-(E)-(un) substituted benzylidene cyclopentanone (I) derivatives and 11 compounds of 2-(E)-(un)substituted benzylidene-5-dimethylaminomethyl cyclopentanone (II) derivatives were synthesized as dual inhibitors of CO/5-LO. Preliminary pharmacological test showed that I4, I12 and I13 given orally have significant inhibiting effect on carrageenan induced rat paw edema and most compounds of type II exhibited potent effect when given subcutaneously. In particular, II3, which inhibited by 95.8%, 70.34%, and 44.2% at 50, 25, and 12.5 mg/kg respectively, was similar to Ibuprofen. Some compounds of type II exhibited anticancer activity both in vitro (IC50 ranging from 2.93 to 18.06 mumol/L on L1210) and in vivo (maximum increase of life span was 97.5% on EAC in mice).
Animals↗
Factor XIII and its substrates, fibronectin, fibrinogen, and alpha 2-antiplasmin, in plasma and urine of patients with nephrosis.
Plasma and urine concentrations of factor XIII and its circulating substrates (fibronectin, fibrinogen, and alpha 2-antiplasmin) were measured in a group of 36 patients with nephrotic syndrome. The results were compared with those obtained in a group of 32 normal volunteers (control group) and 12 patients with end-stage renal disease (ESRD). A mild but significant reduction in plasma level and an abnormal urinary excretion of alpha 2-antiplasmin was found in the nephrotic group. Plasma concentrations of factor XIII, fibronectin, and fibrinogen were significantly elevated in patients with nephrosis. In contrast, patients with ESRD showed no significant difference in the plasma concentrations of either factor XIII, fibronectin, or alpha 2-antiplasmin and only a modest elevation of fibrinogen when compared with normal controls. No significant correlation was found between serum creatinine concentration and plasma levels of factor XIII and its circulating substrates in the nephrotic group. No measurable quantities of factor XIII and only small quantities of fibronectin were found in the urine of patients with nephrosis. Elevation of plasma factor XIII, fibronectin, and fibrinogen concentrations in the nephrotic group is considered to be the result of a combination of increased synthesis and possibly contracted intravascular distribution of these macromolecular proteins in the face of their negligible urinary losses. The presence of the observed abnormalities in the nephrotic group and their absence in the non-nephrotic ESRD group tends to exclude renal failure as a cause of these abnormalities. Although the clinical significance of these abnormalities is uncertain, they can potentially contribute to the thrombophilic diathesis and platelet hyperaggregability in nephrotic syndrome.
Adolescent↗
Two families of monoclonal antibodies to alpha(1----6)dextran, VH19.1.2 and VH9.14.7, show distinct patterns of J kappa and JH minigene usage and amino acid substitutions in CDR3.
Nine groove-type mAb to alpha(1----6)dextran were cloned and sequenced. Together with previous reports from this laboratory, the VH and VL of 34 mAb have been sequenced, in which 10 VH19.1.2 and 11 VH9.14.7 combined with the V kappa-Ox1 gene to form two major families of anti-alpha(1----6)dextrans. The same D minigene (DFL16) was used by all VH19.1.2 and VH9.14.7 mAb; however, the patterns of JH and J kappa usage are quite different. VH19.1.2 mAb used only JH3 and J kappa 2, whereas VH9.14.7 mAb used three JH (JH1, JH2, and JH3) and all four active J kappa (J kappa 1, J kappa 2, J kappa 4, and J kappa 5). Relative uniformity in the lengths of VH CDR3 and the junctional sequences is seen in both families. Some mAb from different mouse strains share common structural features. The differences in idiotypic specificities and in the amino acid sequences suggest that VH19.1.2 and VH9.14.7 may differ in the conformation of CDR1 and CDR2. Combining with V kappa-Ox1 gene to generate groove-type combining sites to the single site-filling epitope of alpha(1----6)dextran, the two VH chains may require certain conformations of CDR3. Whether such conformational requirements influence the choice of J minigenes, the selection of the length of VH CDR3 and the sequences at junctions, are discussed.
Amino Acid Sequence↗
The complete nucleotide sequence of the growth-hormone gene from the common carp (Cyprinus carpio).
We have isolated and sequenced a phase clone from a common carp (Cyprinus carpio) genomic library that carries a gene encoding growth hormone (GH). This gene consists of five exons and four introns spanning a region of about 3 kilobase pairs. Its exons correspond with one of two reported cDNAs of carp GH except for nine differences in the nucleotide sequence, while the encoded amino-acid sequences are identical. The sequence upstream from the transcription start point contains two tandem repeats of AACTCTCATG (from -85 to -62) and the typical TATA box. All the introns start with a consensus GT dinucleotide and end with AG. The arrangement of exons and introns is very similar to that seen in mammalian GH, but quite different from the GH genes of rainbow trout and Atlantic salmon.
Amino Acid Sequence↗
Interleukins, signal transduction, and the immune system-mediated stress response.
Overwhelming evidence indicates that the administration of cytokines such as IL-1 alpha and beta, IL-6, and TNF-1 alpha stimulates one or more components of the HPA axis. The hypothesis driving this research is that host infection and tissue injury trigger the synthesis and release of several cytokines that act locally at sites of trauma and distally upon entering the circulation. Available evidence suggests that the primary source of HPA axis-acting or circulating cytokines is activated monocytes or macrophages; therefore, a direct relationship should exist between the appearance of monokines in plasma and the subsequent appearance of pituitary-adrenocortical hormones in plasma as well. Clarification of the physiological role of monokines as mediators of the host stress response will come from in vivo studies in which the type, sequence of appearance, duration of elevation, and quantification of each monokine is monitored along with ACTH and glucocorticoids, following an appropriate immune challenge. In several recent reports, investigators have administered bacterial-derived endotoxin or LPS to stimulate the physiological events associated with infection or injury and chronicled plasma levels of IL-1, IL-6, and TNF-alpha (37,56,57). In human subjects, endotoxin challenge enhanced plasma TNF-alpha levels by 1 hour, which returned to basal levels by 4 hours (37), whereas, IL-6 plasma activity increased at 2 hours post-challenge and returned to baseline by 6 hours (56). Thus, both of these monokines are implicated as possible acute activators of the HPA axis. In perhaps the most revealing study to date, LPS challenge of mice indicated both a differential appearance and disappearance rate in serum for TNF-alpha and IL-1 and a differential regulation of these monokines by glucocorticoid feedback (57). Serum TNF was detected 45 minutes post-LPS, peaked by 1 hour, and returned to control levels by 3 hours. Serum corticosterone concentrations rose rapidly over a time course similar to that of TNF. Even after serum TNF concentration had returned to basal conditions, corticosterone levels remained maximally elevated, and serum corticosterone was still significantly above basal levels 24-hour post-LPS. The rapid return of circulating TNF to pre-LPS challenge levels appeared to be regulated by negative glucocorticoid feedback, because TNF remained maximally elevated for at least 6 hours in adrenalectomized or hypophysectomized mice. LPS-induced levels of IL-1 were delayed as compared to serum TNF, peaked at 4 hours, and remained elevated even at 24 hours.(ABSTRACT TRUNCATED AT 400 WORDS)
Animals↗
[Toxicity experiment on Sargassum, radix Knoxiae, radix Ransul and flos Genkwa against radix Glycyrrhizae in the antagonism of 18 Chinese drugs].
In order to further look into the cause of the antagonisms in the 18 Chinese medicinal herbs, stimulation and toxicity experiments, with five Chinese medicinal herbs (Sargassum Radix Knoxiae, Radix Kansul and Flos Genkwa against Radix Glycyrrhiza) as a group, were done in healthy rats and rabbits.
Alanine Transaminase↗
[A community-based study on risk factors of hypertension in Luh-Guu Township].
This is a community-based study on hypertension conducted in 1987 to assess the risk of demographic factors and life style of inhabitants aged over 30 in Luh-Guu Township. One-stage cluster sampling was applied. Through home visit interview, the height, weight, and blood pressure as well as demographic and life style data were taken, and 1171 (57.4%) valid data were completed. Hypertension was defined by American National Heart, Lung, Blood Institute as BP greater than = 140/90mmHg. The prevalence of hypertension was 29.2% (the prevalence was 13.4% if defined by the WHO criteria), and only 27.4% of those hypertensives were self-aware. Univariate analysis found that age, educational level, marital status, job condition, smoking habit, father's hypertension history, and usage of contraceptive were correlated with hypertension. With obesity index in addition to the above 6 factors, except contraceptive usage, as independent variables, the multiple logistic regression analysis showed that, only age and obesity index were significantly correlated with hypertension and the best model were fitted.
Adult↗
Purification of duck growth hormone and cloning of the complementary DNA.
Duck growth hormone (GH) was isolated and purified from duck pituitaries by salt precipitation and HPLC on reverse-phase C18 columns. The duck GH was homogeneous as shown by SDS-polyacrylamide gel electrophoresis with a molecular weight of 22,000. The cDNA was synthesized and cloned in Escherichia coli using EcoRI linkers and pBR322 as vector. The positive clones were selected and sequenced. The full-length duck GH cDNA contains 820 nucleotide pairs with an open reading frame coding for the precursor form duck GH of 216 amino-acid residues. The partial amino-acid sequence from the protein completely agrees with that derived from the cDNA, with Phe as the first residue in mature duck GH preceded by a 27-residue hydrophobic signal peptide. The duck GH is almost completely homologous to the chicken GH, with only three conservative substitutions (Ser for Thr, His for Tyr and Lys for Arg) and one deletion (Ala) in the duck GH sequence. Comparison of amino-acid sequence of duck GH with that of various species reveals 56%, 73% and 40% homologies with GHs of human, rat and salmon, respectively.
Amino Acid Sequence↗
Sexual dimorphism of pituitary gonadotropes during postnatal development in the rat.
In the present study both the reverse hemolytic plaque assay for detecting luteinizing hormone (LH) secretion from single cells and LH immunocytochemistry (ICC) were applied to conduct quantitative studies on sexual differences in the gonadotrope population during postnatal development. Pituitary glands from both sexes at different ages were monodispersed with 0.1% trypsin. Freshly dispersed cells were incubated in Cunningham chambers in the presence of 10(-7) M gonadotropin-releasing hormone (GnRH) for measurement of the fraction of plaque-forming cells and the mean size of plaque formed, or attached to glass slides for measurement of the fraction of cells staining for LH by ICC. The percentage of immunostained LH cells increased with age in both sexes from about 5% of the total pituitary cell population at 5 days of age to a plateau of about 10% by 15 days and then fell to the adult level of about 5%. There were no significant sexual differences except at 30 and 40 days of age. In female rats the fraction of LH-secreting cells detected by plaque assay matched closely with that of LH-containing cells detected by ICC. However, there were significant sexual differences in the percentage of LH-secreting cells at day 15 through day 40. The mean LH output from individual cells of both sexes as indicated by the mean size of plaques also increased with age and reached a peak around 50 days. The sexual differences were first seen around 30 days of age with greater amounts in the female than in the male.(ABSTRACT TRUNCATED AT 250 WORDS)
Animals↗
Effect of estrogen on the expression of a cell-surface antigen associated with rat anterior pituitary somatotrophs.
The long-term in vivo effect of diethylstilbestrol (DES) on the expression of a cell-surface antigen associated with the anterior pituitary somatotroph was studied in two strains of female rats using double immunofluorescence techniques. Mab WHC-1, a recently generated and characterized monoclonal antibody, was used to detect the antigen associated with somatotrophs, whereas rabbit anti-rat prolactin (rPRL) and anti-human growth hormone (hGH) antisera were used to identify mammotrophs and somatotrophs, respectively. In F344 rats, Mab WHC-1-positive cells increased from 13.8 +/- 0.5% of total pituitary cells in normal anterior pituitaries to 34.2 +/- 4.0% in DES-induced pituitary tumors. The number of mammotrophs also increased significantly from 58.0 +/- 3.2% in controls to 75.9 +/- 2.2% in tumors. On the other hand, somatotrophs decreased significantly in number following ovariectomy (OVX) and DES implantation (19.7 +/- 0.5% vs. 6.1 +/- 1.2%). Based on double immunofluorescence, the percentage of Mab WHC-1-positive cells, which were somatotrophs, decreased from 85.5 +/- 2.7% in normal controls to 6.7 +/- 1.5% in DES-induced tumors. On the other hand, the percentage of Mab WHC-1-positive cells which were mammotrophs increased significantly from 14.0 +/- 1.4% to 86.1 +/- 1.8% following OVX and DES implantation. A similar change was found in the number of somatotrophs and mammotrophs following the same treatment in Sprague-Dawley (SD) rats which did not develop pituitary tumors. In contrast to F344 rats, the number of Mab WHC-1-positive cells in SD rats decreased significantly from 32.4 +/- 2.8% in sham-operated controls to 19.3 +/- 2.9% in OVX + DES-implanted rats.(ABSTRACT TRUNCATED AT 250 WORDS)
Animals↗
On the Ca++-antagonistic principles of the flower buds of Magnolia fargesii.
Explore the source record for details and available documents.
Animals↗
Production and partial characterization of a monoclonal antibody to rat anterior pituitary somatotrophs.
A cell type-specific monoclonal antibody (Mab) against a cell surface antigen of rat anterior pituitary somatotrophs has been generated by fusion of a nonsecreting mouse myeloma line with spleen cells from a mouse immunized with enzymatically dispersed anterior pituitary cells of adult random cycling female rats. Hybridomas were initially screened for antibodies to cell surface antigens by an enzyme-linked immunosorbant assay using rat anterior pituitary cells and smooth muscle cells of aorta as positive and negative controls, respectively. Positive clones were further checked for cell type specificity by immunofluorescence. Mab WHC-1 is an immunoglobulin M (IgM) with kappa-light chains and is cytotoxic in the presence of complement. Based on double immunofluorescence, this Mab reacted with 22.5 +/- 2.0% (+/- SEM) of the anterior pituitary cells of adult random cycling female rats. Among them, about 93.5 +/- 1.4% were somatotrophs, and only 4.1 +/- 1.2% were mammotrophs. Approximately two thirds of the somatotrophs were Mab WHC-1-positive. The reaction of this Mab with gonadotrophs, thyrotrophs, or corticotrophs were negligible. The percentage of Mab WHC-1-positive cells derived from immunoperoxidase staining was significantly greater than that from immunofluorescence. The cell surface antigen defined by Mab WHC-1 is expressed heavily on GH3 cells, but not on smooth muscle cells. It is resistant to trypsin digestion, but sensitive to ethanol treatment, and exhibits the solubility property of a glycolipid. Mab WHC-1 cross-reacts with the anterior pituitary cell of rabbits, but not mice. These results provide the immunological evidence for heterogeneity among somatotrophs and demonstrate the feasibility of making pituitary cell type-specific Mabs.
Animals↗
Inhibition of exocrine pancreatic secretion by opiates is mediated by suppression of cholinergic transmission: characterization of receptor subtypes.
This study evaluates the hypothesis that opiates suppress pancreatic enzyme secretion by inhibiting cholinergic transmission in the pancreas. Rat pancreatic lobules were incubated in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid-Ringer's buffer and amylase release in response to KCl depolarization of the intrapancreatic nerve in the absence or presence of specific opiate subtype receptor agonists was studied. Depolarization by 75 mM KCl resulted in a 5-fold increase in amylase output. Pretreatment with 1 microM atropine inhibited completely the KCl-stimulated amylase release, suggesting stimulation via a cholinergic pathway. Addition of methionine enkephalin or 2-D-penicillamine-5-D-penicillamine-enkephalin [( D-Pen2, D-Pen5]enkephalin, a specific delta receptor agonist) inhibited KCl-stimulated amylase release in a dose-dependent fashion. Methionine enkephalin (1 microM) or [D-Pen2, D-Pen5]enkephalin inhibited KCl-stimulated amylase release by 32 +/- 4 and 45 +/- 4%, respectively. Addition of 1 microM ICI 174,864 (a delta opiate receptor antagonist) blocked the inhibitory effect of [D-Pen2, D-Pen5]enkephalin. Upjohn 50,488H (1 microM, a specific kappa agonist) and 1 microM Tyr-D-Ala-Gly-MePhe-Gly-ol (a specific mu agonist) had no effect. Methionine enkephalin had no effect on carbachol (1 microM)-stimulated amylase release. These data suggest that methionine enkephalin acts on a delta opiate receptor located on postganglionic cholinergic neurons. To examine the ability of methionine enkephalin to alter acetylcholine release from pancreatic tissue, pancreatic lobules were incubated with [3H]choline and the release of synthesized [3H]acetylcholine was stimulated by KCl. Depolarization of the nerves with 75 mM KCl increased [3H]acetylcholine release by 35 +/- 5% over basal.(ABSTRACT TRUNCATED AT 250 WORDS)
3,4-Dichloro-N-methyl-N-(2-(1-pyrrolidinyl)-cycloh↗
[Mechanism of the acetylcholine-release effect of cisapride on guinea-pig gastrointestinal tract].
Explore the source record for details and available documents.
Acetylcholine↗