Search PubMed⌕ Search

Biomedical subjects

H Ishida

Publications and source records attributed to H Ishida.

At least 469 records · Page 26Linked to original sources
PubMed1996

Block of pancreatic ATP-sensitive K+ channels and insulinotrophic action by the antiarrhythmic agent, cibenzoline.

1. We investigated the effect of cibenzoline (a class Ia antiarrhythmic drug) on basal insulin secretory activity of rat pancreatic islets and ATP-sensitive K+ channels (KATP) in single pancreatic beta cells of the same species, using radioimmunoassay and patch clamp techniques. 2. Micromolar cibenzoline had a dose-dependent insulinotrophic action with an EC50 of 94.2 +/- 46.4 microM. The compound inhibited the activity of the KATP channel recorded from a single beta-cell in a concentration-dependent manner. The IC50 was 0.4 microM in the inside-out mode and 5.2 microM in the cell-attached mode, at pH 7.4. 3. In the cell-attached mode, alkalinization of extracellular solution increased the inhibitory action of cibenzoline and the IC50 was reduced from 26.8 microM at pH 6.2 to 0.9 microM at pH 8.4. On the other hand, the action of cibenzoline in the excised inside-out mode was acute in onset with a small IC50, indicating that the drug attains its binding site from the cytoplasmic side of the cell membrane. 4. In the inside-out mode, micromolar ADP reactivated the cibenzoline-blocked KATP channels in a manner similar to that by which ADP restored ATP-dependent block of the channel. 5. The binding of [3H]-glibenclamide to pancreatic islets was inhibited by glibenclamide but not by cibenzoline. In contrast, the [3H]-cibenzoline binding was displaced by unlabelled cibenzoline but not by glibenclamide. It is concluded that cibenzoline blocks pancreatic KATP channels via a binding site distinct from the sulphonylurea receptor.

Animals↗
PubMed1996

Abnormality in membrane fatty acid compositions of cells measured on erythrocyte in alcoholic liver disease.

It has been proven that the fatty acids of esterified phospholipids in the cell membrane play an important role in membrane fluidity. Our previous in vitro experiment indicated that the impairment of erythrocyte membrane fluidity might be largely because of the change in fatty acids. The aim of this study is to clarify changes of cell membrane fatty acids in more detail in relation to various stages and pathology of alcoholic liver disease. For the analysis, erythrocyte membranes were exploited on the assumption that their fatty acid compositions may be similar to those of other organs. In alcoholic liver disease, unsaturated fatty acids in the erythrocyte membrane decreased and saturated fatty acids increased. Consequently, the unsaturated fatty acid/saturated fatty acid ratio decreased significantly. When fractions of saturated fatty acids were studied, myristic acid (C14:0) increased markedly in the alcoholic group, and the increase was striking particularly in the cases of alcoholic hepatitis concurrently with hemolysis. Palmitic acid (C16:0) also tended to increase in the alcoholic liver disease group. A longer chain saturated fatty acid, stearic acid (C18:0), showed a moderate but significant increase in the alcoholic fatty liver and hepatic fibrosis group, but it decreased significantly in the alcoholic liver cirrhosis, as with the finding in viral liver cirrhosis. As with unsaturated fatty acids, linoleic acid (C18:2), arachidonic acid (C20:4), and eicosapentanoic acid (C20:5) decreased significantly. The arachidonic acid/linoleic acid ratio, which indicates microsomal elongation activity of liver cells, was found to be broadly distributed. No significant change was found in each group of alcoholic liver disease. However, the cases showing a decrease in this ratio had severe hepatic dysfunction concurrently. Thrombogenic Index, serving as an indicator for fatty acids in food, and that is concerned with formation of thrombus, was studied, using fatty acid fractions of the erythrocyte membrane. The index was significantly increased in alcoholic liver disease. It was suggested that the chronic alcohol intake and the resultant liver diseases might enhance the abnormality of the membrane fatty acid composition. These changes may affect cell membrane fluidity and eventually metabolic functions of the cell.

Alcoholism↗
PubMed1996

A case of renovascular hypertension associated with neurofibromatosis.

We report a case of renovascular hypertension associated with neurofibromatosis complicated by moderate proteinuria. A 16-year-old female was admitted to Kensei General Hospital with a complaint of headache and a blood pressure of 230/120 mm Hg. She was referred to us for further evaluation of the hypertension. On examination, cafe-au-lait spots were seen over her extremities and flank, and a bruit was heard in the right upper abdomen. The urinary protein excretion was 2.1 g/day. The plasma renin activity (PRA) and plasma aldosterone concentration were high, but the levels of catecholamines were normal. The renogram was asymmetric and on venous sampling, the PRA in the right renal vein was 58.3 ng/ml/h and that in the left was 22.1 ng/ml/h. CT scan detected an approximately 10-mm mass in the proximal right renal artery. Arteriography disclosed severe stenosis in the right renal artery and the superior mesenteric artery. Therefore, we concluded that her hypertension resulted from stenosis of the right renal artery due to neurofibromatosis. Accordingly, she underwent an operation to reconstruct that artery. After the operation, her blood pressure and PRA normalized without administration of any anti-hypertensive drug and urinary protein disappeared.

Adolescent↗
PubMed1996

Determination of hemoglobin A1C in normal and diabetic mice: neonatal streptozotocin-induced diabetic mice and KK-Ay mice.

We have determined Hemoglobin A1C (HbA1C) in normal, neonatal streptozotocin-induced diabetic animals (NSZ), a model of lean-type non-insulin-dependent diabetes mellitus (NIDDM) with hypoinsulinaemia, and KK-Ay mice, a model of obese-type NIDDM with hyperinsulinaemia. The HbA1C of NSZ mice was slightly increased from 5 to 20 weeks while the HbA1C of KK-Ay mice was markedly increased from 5 to 10 weeks. Our findings showed a difference between experimentally-induced (NSZ) and genetically (KK-Ay) diabetic animals.

Animals↗
PubMed1996

Isolation of inhibitors of TPA-induced mouse ear edema from Hoelen, Poria cocos.

Triterpene carboxylic acids were isolated from the methanol extract of Hoelen, Poria cocos, and found to inhibit 12-O-tetradecanoylphorbol 13-acetate (TAP)-induced mouse ear edema. Their chemical structures were identified as 3 beta,-16 alpha-dihydroxylanosta-7,9(11),24-trien-21-oic acid, 16 alpha-hydroxydehydropachymic acid, 16 alpha-hydroxytrametenolic acid and dehydrotumulosic acid.

Animals↗
PubMed1996

Pathogenesis of drug-induced gingival overgrowth. A review of studies in the rat model.

Drug-induced gingival overgrowth is a side effect associated principally with 3 types of drugs: anticonvulsant (phenytoin), immunosuppressant (cyclosporine A), and various calcium channel blockers (nifedipine, verapamil, diltiazem). In this review, we describe the features of phenytoin-, cyclosporine A- and nifedipine-induced gingival overgrowth in rats and discuss factors influencing the onset and severity of these disorders. There are several features common to the gingival overgrowth induced by these drugs: 1) gingival overgrowth is more conspicuous in the buccal than in the lingual gingiva and less severe in the maxilla than in the mandible; 2) once the blood concentration of the drug reaches a certain level as a result of increasing the dose, the incidence of gingival overgrowth is 100% and its severity is dependent on the blood level, the most severe overgrowth being induced by cyclosporine A; 3) the duration of drug administration for maximal gingival overgrowth to develop is about 40 days; 4) the gingival overgrowth regresses spontaneously after discontinuing the drug; 5) accumulation of dental plaque is not essential for the onset of overgrowth, but plays a role in its severity; and 6) more severe overgrowth is induced in young than in old rats. Furthermore, male rats are more susceptible than females to nifedipine-induced gingival overgrowth. These results suggest that drug-induced gingival overgrowth in rats is dependent on the oral drug dose, blood drug level, age, and sex and that preexisting gingival inflammation is a factor relevant to its severity. Since these factors have also been suggested to be important determinants for human drug-induced gingival overgrowth, the rat model may prove valuable in the future for elucidating the molecular pathogenesis of the disorder.

Age Factors↗
PubMed1996

[Concurrent high-dose thoracic irradiation plus daily low-dose cisplatin and vindesine in locally advanced unresectable stage III non-small cell lung cancer].

Patients with unresectable non small-cell lung cancer were treated to evaluate the toxicity and efficacy of high-dose thoracic irradiation (RT) combined with concurrent daily cisplatin plus vindesine. Fourteen evaluable patients with unresectable stage III non small-cell lung cancer treated with continuous-course RT (70 Gy in 35 fractions of 2 Gy once daily) and concurrent daily intravenous cisplatin (6 mg/m2) plus vindesine (3 mg/m2 on day 1 and day 8). The objective response rate was 86%, and two patients achieved a radiographic complete response. Leukocytopenia was the severe toxicity, but there were no episodes of discontinuation of treatment. Only one patient had grade 3 acute radiation esophagitis. Ten patients experienced late radiation pneumonitis and nine of those had grade 1 or grade 2. There was only one life-threatening case of toxicity (grade 5 pneumonitis). We concluded that the regimen of high-dose thoracic RT combined with concurrent daily cisplatin plus vindesine obtained a high response rate. Further testing on late toxicities and survival time is required.

Aged↗
PubMed1996

Evaluation of retinal microcirculatory alterations in the Goto-Kakizaki rat. A spontaneous model of non-insulin-dependent diabetes.

PURPOSE: To evaluate retinal microcirculation in the spontaneous diabetic GK (Goto-Kakizaki) rat over an extended time. METHODS: The dye-dilution technique with scanning laser ophthalmoscope-based fluorescein angiography was used to evaluate retinal circulation in GK rats with diabetes of 1, 3, and 5 months' duration and in age-matched controls. Scanning laser ophthalmoscope fluorescein angiograms were recorded after a 10-microliter bolus of 10% sodium fluorescein was injected into the tail vein, followed by a flush of 0.1 ml saline. Retinal mean circulation times (MCTs), vessel diameters, and retinal segmental blood flows (SBFs) were determined using computer-assisted image analysis on a frame-by-frame basis. RESULTS: The MCTs were significantly prolonged (P< 0.01) in the GK rat groups (2.60 +/- 0.31, 2.74 +/- 0.28, and 2.84 +/- 0.38 seconds at 1, 3, and 5 months' duration of diabetes, respectively) compared to the age-matched controls (1.94 +/- 0.20, 1.99 +/- 0.12, and 1.91 +/- 0.22 seconds, respectively). No significant differences were observed in the retinal arterial and venous diameters between groups at each time period. The SBFs were significantly reduced (P< 0.03) in the GK rat groups (12.0 +/- 1.5, 12.1 +/- 2.0, and 11.8 +/- 2.5 x 10(2) micrometer squared/second at 1, 3, and 5 months' duration of diabetes, respectively) compared to the controls (16.0 +/- 2.2, 16.7 +/- 1.8, and 17.2 +/- 2.5 x 10(2) micrometer squared/second, respectively). In either group, no significant changes with growth were observed in MCT, vessel diameters, or SBF, although the MCTs in the GK rat group tended to lengthen, and arterial and venous diameters in the GK rat group tended to increase with duration of diabetes. Goto-Kakizaki rats did not exhibit dense cataracts, the retinal circulation could be observed, and morphologic changes of diabetic retinopathy did not develop throughout the experimental period. CONCLUSIONS: A significant prolongation in MCT and a significant reduction in SBF appeared in GK rats at an early stage in diabetes. This tendency continued until 5 months' duration of diabetes. These results suggest that retinal circulatory abnormalities are found before observable retinopathy development in GK rats and that there may be some mechanism causing a reduction in SBF without changing major retinal vessel diameters at an early stage in non-insulin-dependent diabetes mellitus (NIDDM). In addition, this study demonstrates that the GK rat will be a useful model of non-insulin-dependent diabetes mellitus to evaluate retinal circulation over an extended time.

Animals↗
PubMed1996

[Flow cytometric analysis of the DNA content of resected non-small cell lung cancer with reference to long-term follow-up].

We measured the cellular DNA content of paraffin-embedded tumor specimens by flow cytometry from 340 cases of resected non-small cell lung cancer, and investigated the correlation of DNA content and prognosis of these cases with long-term follow-up. These 340 cases were divided into some populations according to pathological stage, histologic type, surgical curativity and N factor, and we compared the prognosis of DNA diploidy cases and DNA aneuploidy cases in each population. DNA aneuploidy cases had a significantly less favorable prognosis than DNA diploidy cases in population of stage I adenocarcinoma, stage IIIA non-small cell lung cancer and N2 cases among stage IIIA non-small cell lung cancer, all after curative operation. But in other populations, there was no significant difference in prognosis between DNA diploidy cases and DNA aneuploidy cases. In conclusion, DNA ploidy pattern is a prognostic factor for survival in patients with stage I adenocarcinoma and N2 cases of stage IIIA non-small cell lung cancer.

Adenocarcinoma↗
PubMed1996

[Clinicopathological study on primary lung cancer--immunohistochemical expression of p53 suppressor gene and bcl-2 oncogene in relation to prognosis].

Two hundred and eleven surgically resected primary lung tumors were studied immunohistochemically. According to histologic type, they were 129 adenocarcinomas, 56 squamous cell carcinomas, 4 small cell carcinomas, 8 large cell carcinomas, 8 adenosquamous cell carcinomas, 5 so-called carcinosarcomas and 2 other tumors. Immunohistochemical expression of p53 and bcl-2 was studied in relation to the disease-free survival. Among the 211 patients with lung cancer, 109 were positive for p53 expression, and there was no significant relationship between p53 expression and sex, or clinicopathological stage and size of the tumor, although the patients with squamous cell carcinoma had a significantly higher frequency of p53 expression than those with adenocarcinomas. The frequency of p53 expression was significantly higher in the patients with poorly differentiated adenocarcinomas than in those with other histologic types. Seventy four of the 211 patients were positive for bcl-2 expression and bcl-2 expression was higher in the stage I patients and patients with small lung tumors 2cm or less in diameter than in the other patients. The patients with adenocarcinoma had a higher frequency of expression than those with squamous cell carcinoma but no difference was found in the histological differentiation of the tumor. The 5-year survival of patients positive for p53 expression was poorer than that of those with negative expression and the survival rate was higher in the patients positive for bcl-2 expression than in those with negative expression. These findings suggested that the expression of p53 and bcl-2 is a useful marker of follow-up and prognosis, but will require more data concerning the mechanism of carcinogenesis. Seven cases of primary lung cancer were examined for genetic abnormality of the p53 gene. cDNA was synthesized from total RNA of primary tissues of lung cancer using oligo (dT) primer and reverse transcriptase and polymerase chain reaction (RT-PCR), and PCR-single strand conformation polymorphism (SSCP) analysis were performed. Five patients gave a positive result upon PCR-SSCP analysis of the p53 gene. To confirm the results of PCR-SSCP analysis, their nucleotide sequences were further analyzed and four of them had point mutations at different codons (154, 176, 207, 236) and one had deletion of one nucleotide (245) in exon 5 and 8. Fifteen percent of 26 patients with small peripheral lung adenocarcinomas less than 2cm in diameter were already advanced in stage and various factors such as vascular invasion, pleural involvement and degree of scar grade were higher than in patients with clinicopathological stage I. In advanced cases, the frequencies of p53 expression was higher than in stage I cases. Concerning the relationship of the degree of scar grade to PDGF-B expression, we demonstrated the production of PDGF-B protein immunohistochemically and the expression of PDGF-B-mRNA by In situ hybridization in the adenocarcinoma cells and macrophages of the lung tumors. However, no significant correlation was observed between the degree of PDGF-B expression and collagen production in the fibrotic focus.

Adenocarcinoma↗
PubMed1996

[A case of Borrmann type 4 gastric cancer successfully treated with MTX and 5-FU therapy through the hepatic artery].

A 73-year-old male was diagnosed as having a Borrmann type 4 gastric cancer with multiple liver metastases. Total gastrectomy (D2) with hepatic arterial cannulation was performed. Hepatic arterial infusion therapy of MTX (50 mg or 100 mg/body) and 5-FU (500 mg or 750 mg/body) was started postoperatively. A total dose of 1,150 mg of MTX and 6,250 mg of 5-FU caused a marked decrease in the volume of liver metastases and the effect remained for 8 months (partial response). Regarding drug concentrations, serum MTX levels rapidly decreased after bolus injection through hepatic artery and corresponded to those of intravenous injection as reported elsewhere. Serum 5-FU levels were maintained as low as 1.2 micrograms/ml during 2-hr continuous infusion and rapidly decreased after the end of the infusion. These results indicate that hepatic arterial infusion therapy of MTX and 5-FU may be safe and feasible for multiple liver metastases of Borrmann type 4 gastric cancer.

Adenocarcinoma↗
PubMed1996

[Surgical treatment of pancreatic cancer and its prognosis-long-term therapeutic results after resection].

A total of 15,731 pancreatic cancer cases were registered by the Pancreatic Cancer Registration Committee of the Japan Pancreas Society (JPS) in a period of over 14 years. Tumor resection was performed in 35.4% of the total. The five-year actuarial survival rate of resected cases was 17.5%. 130 patients histologically confirmed had long-term (over 5 years) survival, among whom were only 7 patients with n3, pv3, ly3, a3 and pl (+) as histological criteria by JPS. The combined use of radiation therapy and chemotherapy after resection for Stage I, Stage II and Stage III disease proved effective. According to the National Cancer Data Base (NCDB), though the resection rate was only 14.2%, the long-term survival rate was similar to that by JPS, because Stage IV disease was only 8% of patients who received resection in NCDB's report. Selected patients seemed to be allowed to undergo resection. We concluded that it was very important to select patients to improve therapeutic results for pancreatic cancer.

Humans↗
PubMed1996

[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells].

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.

Antigen-Antibody Complex↗
PubMed1995

IL-10 is involved in the protective effect of dibutyryl cyclic adenosine monophosphate on endotoxin-induced inflammatory liver injury.

The effects of exogenous cAMP, dibutyryl cAMP (DBcAMP) on LPS-induced liver injury were examined in mice made hypersensitive to LPS by treatment with i.v. injection of Propionibacterium acnes. In vivo administration of DBcAMP significantly protected P. acnes-treated mice from LPS-induced liver injury, including apoptosis of hepatocytes. DBcAMP significantly increased circulating IL-10 level in correlation with suppression of the TNF-alpha level after LPS challenge in P. acnes-treated mice. Treatment with anti-IL-10 mAb abrogated the protective effect of DBcAMP on LPS-induced liver injury. Similar to in vivo findings, addition to DBcAMP to in vitro culture of liver adherent cells from P. acnes-treated mice enhanced IL-10 synthesis after LPS stimulation. These results suggest that the increment in IL-10 production by liver adherent cells is involved in the protective effect of DBcAMP on LPS-induced inflammatory liver injury.

Animals↗