Leader sequence of 71 nucleotides devoid of G in tobacco mosaic virus RNA.
Explore the source record for details and available documents.
Biomedical subjects
Publications and source records attributed to H Guilley.
Explore the source record for details and available documents.
In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.
The experiments described in this paper and the following one establish the sequence of the 3'-OH terminal 159 nucleotides of turnip yellow mosaic virus RNA. Uniformly 32P-labeled turnip yellow mosaic virus RNA was partially digested with T1 ribonuclease and the fragments were fractionated by polyacrylamide gel electrophoresis. Fragments originating from the 3'-OH end of the RNA molecule were identified by testing for the 3'-terminal oligonucleotide, C-COH, after total U2 ribonuclease hydrolysis. Once identified, the 3'-OH terminal fragments were sequenced by the methods of Sanger et al. The first 51 nucleotides of the longest of the sequenced fragments (158 nucleotides) extends into the 3'-terminal part of the coat protein cistron. The coat protein cistron is followed by a stretch of 108 untranslated nucleotides whose function, though still unknown, is probably linked to the tRNA-like properties which have been attributed to the 3'-OH extremity of this viral RNA. Two possible secondary structures are proposed for the sequence and the implications of the findings with regard to the tRNA-like properties of the extremity are discussed.
The in vitro reconstitution of tobacco mosaic virus (TMV) is initiated by the binding of a disk of TMV protein to the 'disk recognition site', a region of the RNA chain at or near the 5'-terminus for which the disk has special affinity. In order to gain insight into the recognition process, we have studied the ability of disks to encapsidate short RNA fragments produced by partial pancreatic or T1 RNase digestion of TMV RNA. The disk is capable of dicriminating among such fragments, encapsidating only a few of the many present in the digest. The products of encapsidation are short nucleoprotein rods of the same diameter as TMV and of length proportional to that of the encapsidated RNA fragment. The particles differ from TMV, however, in one significant aspect (apart from their length): they possess rings of RNA-free protein at one or both extremities of the rod. In the case of T1 RNase digestion the principal encapsidated fragments were fragments T1 (105 nucleotides) and a family of smaller fragments containing elements of the same sequence. Partial digestion with pancreatic RNase generated only one major fragment (fragment P1; 150 nucleotides) with affinity for the disk. Fragment T1 has been sequenced and shown to represent a portion of the coat protein cistron. Fragment P1 has been partially sequenced but its function is not yet known. Several lines of evidence indicate that fragment T1 is not the disk recognition site. The portion of the TMV RNA chain from which fragment P1 is derived, on the other hand, is encapsidated early in the reconstitution process; thus fragment P1 may contain the disk recognition site. Fragment T1 and fragment P1 both have purine-rich and cytosine-poor sequences near their termini. In addition, fragment T1, and possibly fragment P1, possess a periodicity of order three in purine residues. It seems likely that one or both of the aforesaid properties are largely responsible for the affinity of these fragments for the disk.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
The sequence of the first 71 nucleotides from the 3'-OH end of tobacco mosaic virus RNA has been determined. After total T1 ribonuclease digestion of the viral RNA, the oligonucleotide C-C-C-A-OH, which originates from the 3'-OH terminus of the RNA, may be readily detected by electrophoresis at pH 2.5 or pH 3.0; it is the only oligonucleotide that migrates toward the cathode at these pHs. This property has been used to screen the purified products of partial T1 ribonuclease digestion of tobacco mosaic virus RNA for the fragment originating from the 3'-end of the native molecule. The sequence of nucleotides in the 3'-terminal fragment, identified in this manner, was determined by radiochemical methods. The fragment contained 71 nucleotides; no abnormal bases could be detected. Although it has been reported that the 3'-end of tobacco mosaic virus RNA is a substrate for aminoacylation by the histidyl-tRNA synthetase of yeast or Escherichia coli, we were unable to fold the sequence into the cloverleaf structure characteristic of tRNAs.
When 25-S tobacco mosaic virus (TMV) protein aggregate and TMV RNA, which has been partially digested by T1 RNase, are mixed under conditions suitable for reconstitution, only a few RNA fragments are encapsidated. These fragments were isolated and purified by polyacrylamide gel electrophoresis. The sequence of the three main fragments, the longest of which (fragment 1) was estimated to contain 103 nucleotides, has been determined. The two smaller fragments are portions of the longer chain produced by an additional specific scission. Because of the great affinity of 25-S TMV protein for this nucleotide sequence, it will be referred to as the "specifically encapsidated RNA fragment". The occurrence of a "hidden break" in the sequence has been demonstrated: fragment 1, purified by electrophoresis on a polyacrylamide gel without 8 M urea, gives rise upon further electroporesis in the presence of urea to two new bands corresponding to the two halves of the molecule. A stable hair-pin secondary structure has been derived from the base sequence which can account for the specificity of action of the enzyme. Because of its properties, we have suggested elsewhere that the sequence of fragment 1 might correspond to the disk recognition site for reconstitution, which is known to be located at the 5' end of the intact RNA. But experiments with TMV RNA whose 5'-OH end has been radioactively phosphorylated with polynucleotide kinase show that this is not the case. Analysis of the amino acid coding capacity of the fragment has instead revealed that fragment 1 is a portion of the TMV coat protein cistron.
The incubation of 25-S tobacco mosaic virus (TMV) protein with a mixture of RNA fragments produced by partial T1 RNase digestion of TMV RNA results in the encapsidation of only a few species of RNA. In addition to the most predominant species, fragment 1, whose sequence has been described in the prededing paper, two other species, fragment 41 and fragment 21 are coated by the protein. These two RNA fragments were purified by polyacrylamide gel electrophoresis and subjected to total digestion with pancreatic and T1 RNase. The oligonucleotides were separated by paper electrophoresis and characterized insofar as possible by digestion with the complementary ribonuclease. From the amino acid coding capacity of the oligonucleotides liberated from fragments 41 and 21 by T1 RNase digestion, it appears that these two fragments, like fragment 1, are derived from the coat protein cistron. They are situated immediately prior to fragment 1 and, together with this fragment, consitute a continuous stretch of 232 nucleotides of the cistron which codes for animo acids 53 to 130 of the coat protein. The order of the fragments in the sequence is 21-41-1. A possible model for the secondary structure of this portion of the sequence is proposed.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.