Search PubMed⌕ Search

Biomedical subjects

H F DeLuca

Publications and source records attributed to H F DeLuca.

At least 37 records · Page 2Linked to original sources
PubMed2000

Expression of 1,25-dihydroxyvitamin D(3) receptor in the immune system.

In addition to its role in calcium and skeletal homeostasis, there is increasing evidence that the hormonal form of vitamin D, 1, 25-dihydroxyvitamin D(3), appears to serve as a modulator of the immune system. We have determined the level of the 1, 25-dihydroxyvitamin D(3) receptor (VDR) in resting and activated lymphocytes by immuno- and ligand-binding assays. As expected from previous work, the total T lymphocyte population contains VDR whose levels are increased when activated and treated with 1, 25-dihydroxyvitamin D(3). Surprisingly, the highest concentrations of VDR are found in CD8 lymphocytes, although significant amounts are also present in CD4 lymphocytes. Furthermore, B lymphocytes do not contain detectable amounts of VDR. Cells of the monocyte/macrophage lineage possess small amounts of VDR that are not affected by activation but are increased by treatment with 1, 25-dihydroxyvitamin D(3). These results suggest that CD8 lymphocytes may be a major site of 1,25-dihydroxyvitamin D(3) action, while B lymphocytes are likely not directly regulated by 1, 25-dihydroxyvitamin D(3).

Animals↗
PubMed2000

Three-dimensional modeling of and ligand docking to vitamin D receptor ligand binding domain.

The ligand binding domain of the human vitamin D receptor (VDR) was modeled based on the crystal structure of the retinoic acid receptor. The ligand binding pocket of our VDR model is spacious at the helix 11 site and confined at the beta-turn site. The ligand 1alpha, 25-dihydroxyvitamin D(3) was assumed to be anchored in the ligand binding pocket with its side chain heading to helix 11 (site 2) and the A-ring toward the beta-turn (site 1). Three residues forming hydrogen bonds with the functionally important 1alpha- and 25-hydroxyl groups of 1alpha,25-dihydroxyvitamin D(3) were identified and confirmed by mutational analysis: the 1alpha-hydroxyl group is forming pincer-type hydrogen bonds with S237 and R274 and the 25-hydroxyl group is interacting with H397. Docking potential for various ligands to the VDR model was examined, and the results are in good agreement with our previous three-dimensional structure-function theory.

Amino Acid Sequence↗
PubMed2000

Mechanism of action of superactive vitamin D analogs through regulated receptor degradation.

We and others have previously shown that selected vitamin D analogs potentiate the vitamin D receptor (VDR) mediated transcription much more efficiently than the natural hormone itself. Here we show that the transcriptionally active 20-epi analogs, namely KH 1060 and MC 1288, protect VDR against degradation more efficiently than calcitriol at 10(-10) M concentration (VDR t(1/2) > 48 h, 17 h, and 10 h, respectively). The conformationally epi-like analog EB 1089 did not significantly alter the half-life of VDR (10.3 h), but retained the VDR levels over longer periods of time than calcitriol. The transcriptionally weak analog GS 1558, on the other hand, enhanced VDR degradation even more than what was observed with the unliganded receptor (t(1/2) 4.5 h and 5 h, respectively). Inhibition of proteasome activity by the inhibitor MG-132 resulted in a marked increase in the VDR levels in cells treated with the vehicle or GS 1558 (2.5-fold and 2.7-fold, respectively), more than twice the levels observed in the presence of calcitriol or EB 1089 (1.2-fold and 1.1-fold, respectively). MG-132 treatment did not increase the VDR levels in cells treated with KH 1060 or MC 1288. The electrophoretic mobility shift assay (EMSA) with nuclear extracts from MG-132-treated cells revealed formation of a high-molecular-weight RXRbeta-VDR-VDRE complex, which also contained Sug1. In the presence of calcitriol, 34% of total VDR in its DNA binding state was present in this complex. The 20-epi analogs effectively prevented the formation of this complex, since, in this case, only 16% of total VDR was found in this complex. These results suggest that KH 1060 and MC 1288 induce a VDR conformation, which prevents binding of proteins mediating receptor degradation. As a result, the regulation of VDR degradation differs from that found with the calcitriol-VDR complex resulting in superactive transcriptional action of the analogs.

Calcitriol↗
PubMed2000

Isolation and characterization of the chicken vitamin D receptor gene and its promoter.

The sequences from several independent cDNA clones encoding the chicken vitamin D receptor as well as primer extension assay have clearly delineated the 5' terminus and the transcriptional start site. Screening a chicken genomic library produced genomic clones containing vitamin D receptor (VDR) gene fragments. Restriction map of clone 8 showed that the 18.6-kb chicken VDR fragment has exons 1 and 2, intron 1, part of intron 2, and 7-kb 5' flanking region. Exons 1, 2, and 3 found in the chicken VDR gene shares low homology with its mammalian counterparts (i.e., E1A, E1B, and E1C in human). By contrast, the fourth exon and following exons for the coding region of VDR gene are highly conserved between avian and mammalian species. While the fourth exon bears the ATG sites for translation initiation in mammals, the third exon in birds has two extra ATG sites for leaky translation as determined previously. Thus, the avian VDR has more N-terminal sequence than the mammalian VDR and is found in two distinct forms. The 5' flanking region from genomic clone 8 shares considerable homology in several regions with the human and mouse VDR promoters. Moreover, the 5' flanking region of chicken VDR gene possesses promoter activity, as shown by its ability to drive the luciferase reporter gene in cell transfection assays. Like other steroid receptor promoters, the chicken VDR promoter contains no TATA box but possesses several GC boxes or SP1 sites. A series of deletional promoter constructs established that the proximal GC boxes are the major drivers of gene transcription, while the more upstream sequences have repressive elements.

Animals↗
PubMed1999

A characterization of vitamin D-independent intestinal calcium absorption in the osteopetrotic (op/op) mouse.

Previous work in our laboratory showed that the osteopetrotic (op/op) mouse possesses a vitamin D-independent mechanism of intestinal calcium absorption. This study was performed in an effort to further characterize the mechanism. The vitamin D-deficient op/op mouse absorbed calcium faster than either a vitamin D-deficient or 1, 25-dihydroxyvitamin D(3)-supplemented wild-type mouse. This increased rate of absorption was not found at concentrations of calcium that result in diffusional calcium absorption. Thus, vitamin D-deficient op/op mice had intestinal calcium absorption similar to that of vitamin D-deficient wild-type littermates when increasing levels of calcium were administered. Also, mRNA and protein levels of calbindin-D9k were similar in vitamin D-deficient wild-type and op/op mice as well as in wild-type and op/op mice treated with 1, 25-dihydroxyvitamin D(3). Therefore, the mechanism of vitamin D-independent intestinal calcium absorption in the op/op mouse is distinct from vitamin D-dependent intestinal calcium absorption.

Animals↗
PubMed1999

DNA bending is induced by binding of vitamin D receptor-retinoid X receptor heterodimers to vitamin D response elements.

The ability of vitamin D receptor-retinoid X receptor (VDR-RXR) heterodimers to induce a DNA bend upon binding to various vitamin D response elements (VDRE) has been investigated by circular permutation and phasing analysis. Recombinant rat VDR expressed in the baculovirus system and purified recombinant human RXR beta have been used. The VDREs were from 1,25-dihydroxyvitamin D3 (1,25-[OH]2D3) enhanced genes (rat osteocalcin, rOC; mouse osteopontin, mOP, and rat 1,25-dihydroxyvitamin D3-24-hydroxylase, r24-OHase), and a 1,25-(OH)2D3 repressed gene (human parathyroid hormone, hPTH). As shown by circular permutation analysis, VDR-RXR induced a distortion in DNA fragments containing various VDREs. Calculated distortion angles were similar in magnitude (57 degrees, 56 degrees, 61 degrees, and 59 degrees, respectively for rOC, mOP, r24-Ohase, and hPTH). The distortions took place with or without a 1,25-(OH)2D3 ligand. The centers of the apparent bend were found in the vicinity of the midpoint of all VDREs, except for rOC VDRE which was found 4 bp upstream. Phasing analysis was performed with DNA fragments containing mOP VDRE and revealed that VDR-RXR heterodimers induced a directed bend of 26 degrees, not influenced by the presence of hormone. In this study we report that similar to other members of the steroid and thyroid nuclear receptor superfamily, VDR-RXR heterodimers induce DNA bending.

Animals↗
PubMed1999

Calcitonin is a major regulator for the expression of renal 25-hydroxyvitamin D3-1alpha-hydroxylase gene in normocalcemic rats.

Regulation of vitamin D metabolism has long been examined by using vitamin D-deficient hypocalcemic animals. We previously reported that, in a rat model of chronic hyperparathyroidism, expression of 25-hydroxyvitamin D3-1alpha-hydroxylase (CYP27B1) mRNA was markedly increased in renal proximal convoluted tubules. It is believed that the major regulator for the expression of renal CYP27B1 is parathyroid hormone (PTH). However, in the normocalcemic state, the mechanism to regulate the renal CYP27B1 gene could be different, since plasma levels of PTH are very low. In the present study, the effect of PTH and calcitonin (CT) on the expression of renal CYP27B1 mRNA was investigated in normocalcemic sham-operated rats and normocalcemic thyroparathyroidectomized (TPTX) rats generated by either PTH or CaCl2 infusion. A single injection of CT dose-dependently decreased the expression of vitamin D receptor mRNA in the kidney of normocalcemic sham-TPTX rats. Concomitantly, CT greatly increased the expression of CYP27B1 mRNA in the kidney of normocalcemic sham-TPTX rats. CT also increased the expression of CYP27B1 mRNA in the kidney of normocalcemic TPTX rats. Conversion of serum [3H]1alpha,25(OH)2D3 from 25-hydroxy[3H]vitamin D3 in vivo was also greatly increased by the injection of CT into sham-TPTX rats and normocalcemic TPTX rats, but not into hypocalcemic TPTX rats. In contrast, administration of PTH did not induce the expression of CYP27B1 mRNA in the kidney of vitamin D-replete sham-TPTX rats and hypocalcemic TPTX rats. PTH increased the expression of renal CYP27B1 mRNA only in vitamin D-deficient hypocalcemic TPTX rats. These results suggest that CT plays an important role in the maintenance of serum 1alpha,25(OH)2D3 under normocalcemic physiological conditions, at least in rats.

25-Hydroxyvitamin D3 1-alpha-Hydroxylase↗
PubMed1999

Identification of a transcription factor that binds to the promoter region of the human parathyroid hormone gene.

A putative transcription factor binds a site adjacent to the negative vitamin D responsive element (VDRE) in the promoter region of the human parathyroid hormone gene. Deletion and mutation analysis reveal the binding site for this factor overlaps with the proximal repeat element of the VDRE. It includes additional nucleotides at the 3' end of the VDRE. This site has the sequence TTTGAACCTATAGTTGAGAT and a core sequence TGAACCTAT needed for binding of the factor. Experiments with specific anti-vitamin D receptor (VDR) antibodies demonstrate that VDR is not found in the factor/DNA complex. However, removing the VDR from the nuclear extract by immunoprecipitation eliminated the binding complex, and the addition of recombinant VDR to the depleted extract did not restore the factor's ability to bind to the DNA, suggesting that the factor and VDR are closely associated. Transfection experiments with various reporter constructs indicate that the factor is required for the high transcriptional activity of the human PTH gene. This high activity is significantly suppressed by 1,25-dihydroxyvitamin D3. This factor seems to be expressed in several cell types including rat osteoblasts and pituitary. Additionally, some human cancer cell lines express a high level of this factor.

Animals↗
PubMed1999

Bacterial expression and characterization of the ligand-binding domain of the vitamin D receptor.

The ligand-binding domain of the rat vitamin D receptor (amino acids 115-423) was expressed as an amino-terminal His-tagged protein in a bacterial expression system and purified over Ni-nitrilotriacetic acid resin and a Mono S column. The purified protein bound its ligand, 1,25-dihydroxyvitamin D3, with high affinity, similar to that of the full-length protein. Saturation of the protein with ligand quenched 90% of the tryptophan fluorescence, consistent with the purified protein being uniformly able to bind ligand. Addition of ligand produced no change in the tryptophan fluorescence lifetime, suggesting static quenching as the mechanism of fluorescence decrease. The near-UV circular dichroism spectrum showed a large increase in signal following the addition of ligand, consistent with a change in the environment of aromatic amino acid side chains. The far-UV circular dichroism spectrum was consistent with a protein of high alpha-helical content. Sedimentation equilibrium experiments demonstrated that the protein formed higher-order complexes, and the distribution of the protein among these complexes was significantly shifted by addition of ligand.

Animals↗
PubMed1999

Synthesis and biological activity of 22-iodo- and (E)-20(22)-dehydro analogues of 1alpha,25-dihydroxyvitamin D3.

Construction of 25-hydroxy-steroidal side chain substituted with iodine at C-22 was elaborated on a model PTAD-protected steroidal 5,7-diene and applied to a synthesis of (22R)- and (22S)-22-iodo-1alpha,25-dihydroxyvitamin D3. Configuration at C-22 in the iodinated vitamins, obtained by nucleophilic substitution of the corresponding 22S-tosylates with sodium iodide, was determined by comparison of their iodine-displacement processes and cyclizations leading to isomeric five-membered (22,25)-epoxy-1alpha-hydroxyvitamin D3 compounds. Also, 20(22)-dehydrosteroids have been obtained and their structures established by 1H NMR spectroscopy. When compared to the natural hormone, (E)-20(22)-dehydro-1alpha,25-dihydroxyvitamin D3 was found 4 times less potent in binding to the porcine intestinal vitamin D receptor (VDR) and 2 times less effective in differentiation of HL-60 cells. 22-Iodinated vitamin D analogues showed somewhat lower in vitro activity, whereas (22,25)-epoxy analogues were inactive. Interestingly, it was established that (22S)-22-iodo-1alpha,25-dihydroxyvitamin D3 was 3 times more potent than its (22R)-isomer in binding to VDR and four times more effective in HL-60 cell differentiation assay. The restricted mobility of the side chain of both 22-iodinated vitamin D compounds was analyzed by a systematic conformational search indicating different spatial regions occupied by their 25-oxygen atoms. Preliminary data on the in vivo calcemic activity of the synthesized vitamin D analogues indicate that (E)-20(22)-dehydro-1alpha,25-dihydroxyvitamin D3 and 22-iodo-1alpha,25-dihydroxyvitamin D3 isomers were ca. ten times less potent than the natural hormone 1alpha,25-(OH)2D3 both in intestinal calcium transport and bone calcium mobilization.

Animals↗
PubMed1999

Dietary calcium is a major factor in 1,25-dihydroxycholecalciferol suppression of experimental autoimmune encephalomyelitis in mice.

The active form of vitamin D (1,25-dihydroxycholecalciferol) is a potent immune system regulator. Treating mice with 1, 25-dihydroxycholecalciferol and feeding them diets high in calcium can completely suppress the induction of experimental autoimmune diseases such as experimental autoimmune encephalomyelitis (EAE). Experiments described here were carried out on mice in which development of EAE was induced. Mice were fed diets containing various amounts of calcium and 1,25-dihydroxychole-calciferol. Variables measured were as follows: 1) incidence and severity of EAE; 2) serum calcium concentrations; 3) body weight; 4) total number of cells in the lymph nodes; and 5) interleukin-4 (IL-4) and transforming growth factor-beta1 (TGF-beta1) mRNA levels. When calcium was removed from the diet, the incidence of EAE was reduced 20% in both males and females. Further, the lower the dietary level of calcium, the higher was the dose of 1,25-dihydroxycholecalciferol required to prevent the symptoms. Thus, 1, 25-dihydroxycholecalciferol was found most effective in mice fed a diet adequate or high in calcium. 1,25-Dihydroxycholecalciferol treatment of mice fed high dietary calcium resulted in a decreased number of lymphocytes in the lymph nodes and increased IL-4 and TGF-beta1 mRNA levels. When calcium was omitted from the diet, 1, 25-dihydroxycholecalciferol supplementation increased TGF-beta1 mRNA. Increased IL-4 mRNA and decreased lymphocytes in the lymph nodes in response to 1,25-dihydroxycholecalciferol occurred only when dietary calcium was adequate or high. Our results suggest that dietary calcium and 1,25-dihydroxycholecalciferol are both involved in the prevention of symptomatic EAE.

Animals↗
PubMed1999

Vitamin A antagonizes the action of vitamin D in rats.

Interactions between vitamin A and vitamin D have been suggested for several decades but have not been established. In particular, vitamin A has been proposed to intensify the severity of the bone mineralization disease, rickets and inhibit the ability of vitamin D to cure this disease. To investigate this hypothesis, weanling Holtzman rats were fed a 1.2% calcium, 0.1% phosphorus diet and 15.5 ng ergocalciferol (vitamin D(2)) every 3 d for 21 d in the presence of increasing amounts of retinyl acetate (0 microg to 8621 microg/d). The increasing amounts of retinyl acetate produced a progressive and significant decrease in total bone ash (P < 0.001) and an increase in epiphyseal plate width (P < 0.001). The same experiment conducted with increasing amounts of vitamin D(2) (0 to 645 ng/d) indicated that the antagonism by retinyl acetate could be demonstrated at all vitamin D(2) dosages. To further investigate this antagonistic relationship, weanling Holtzman rats were fed a 0. 47% calcium, 0.3% phosphorus diet and 15.5 ng vitamin D(2) every 3 d for 33 d in the presence of increasing retinyl acetate (0 to 3448 microg/d). In the absence of retinyl acetate, these rats maintained a normal serum calcium level (2.34 mmol/L). Increasing retinyl acetate, however, eliminated the ability of vitamin D(2) to elevate the level of serum calcium (1.35 mmol/L). These results illustrated in vivo antagonism of vitamin D(2) action on intestine and bone by retinyl acetate.

Animals↗
PubMed1998

Additional protein factors play a role in the formation of VDR/RXR complexes on vitamin D response elements.

The vitamin D receptor (VDR) elicits a transcriptional response to 1,25-dihydroxyvitamin D3 by binding to specific response elements (VDRE) in the promoter of target genes. Retinoic X receptor (RXR) is required for formation of the VDR-VDRE complex when VDR is supplied at physiologic concentrations. When porcine intestinal nuclear extract is used as a source of VDR, two distinct complexes are always observed with native gel electrophoresis. Both complexes contain VDR and RXR. We now show that the faster-migrating complex requires another heretofore unknown nuclear factor for its formation. In addition, we provide evidence that the formation of the slower-migrating complex is enhanced by transcription factor IIB (TFIIB). Using ligand binding assays, we determined that both complexes contain the same ratio of VDR to VDRE. Using RXR subtype-specific antibodies in gel shift assays, we show that the complexes contain more than one RXR subtype. Therefore, the present results demonstrate VDR-RXR-VDRE complexes formed with pig intestinal nuclear extracts contain other proteins and that the complexes formed between VDR and VDRE are not simply heterodimers of VDR and RXR.

Cytochrome P-450 Enzyme System↗
PubMed1998

Defects in embryonic hindbrain development and fetal resorption resulting from vitamin A deficiency in the rat are prevented by feeding pharmacological levels of all-trans-retinoic acid.

Vitamin A is required for reproduction and normal embryonic development. We have determined that all-trans-retinoic acid (atRA) can support development of the mammalian embryo to parturition in vitamin A-deficient (VAD) rats. At embryonic day (E) 0.5, VAD dams were fed purified diets containing either 12 micrograms of atRA per g of diet (230 micrograms per rat per day) or 250 micrograms of atRA per g of diet (4.5 mg per rat per day) or were fed the purified diet supplemented with a source of retinol (100 units of retinyl palmitate per day). An additional group was fed both 250 micrograms of atRA per g of diet in combination with retinyl palmitate. Embryonic survival to E12.5 was similar for all groups. However, embryonic development in the group fed 12 micrograms of atRA per g of diet was grossly abnormal. The most notable defects were in the region of the hindbrain, which included a loss of posterior cranial nerves (IX, X, XI, and XII) and postotic pharyngeal arches as well as the presence of ectopic otic vesicles and a swollen anterior cardinal vein. All embryonic abnormalities at E12.5 were prevented by feeding pharmacological amounts of atRA (250 micrograms/g diet) or by supplementation with retinyl palmitate. Embryos from VAD dams receiving 12 micrograms of atRA per g of diet were resorbed by E18.5, whereas those in the group fed 250 micrograms of atRA per g of diet survived to parturition but died shortly thereafter. Equivalent results were obtained by using commercial grade atRA or atRA that had been purified to eliminate any potential contamination by neutral retinoids, such as retinol. Thus, 250 micrograms of atRA per g of diet fed to VAD dams (approximately 4.5 mg per rat per day) can prevent the death of embryos at midgestation and prevents the early embryonic abnormalities that arise when VAD dams are fed insufficient amounts of atRA.

Animals↗
PubMed1998

New 1alpha,25-dihydroxy-19-norvitamin D3 compounds of high biological activity: synthesis and biological evaluation of 2-hydroxymethyl, 2-methyl, and 2-methylene analogues.

New highly active isomers of the natural hormone 1alpha, 25-dihydroxyvitamin D3 possessing an exomethylene group at the 2-position were prepared in a convergent manner, starting with (-)-quinic acid and the corresponding (20R)- and (20S)-25-hydroxy Grundmann ketones. These 2-methylene-19-norvitamins were efficiently converted to the 2-methyl and 2-hydroxymethyl derivatives, some of which exhibited pronounced in vivo biological activity. Configurations of the A-ring substituents were determined by 1H NOE difference spectroscopy as well as by spin decoupling experiments. It was established that the bulky methyl and hydroxymethyl substituents at C-2, due to their large conformational free energies, occupy mainly equatorial positions. Additionally, hydroxylation of the C(10)-C(19) double bond in 1alpha,25-(OH)2D3 was performed, resulting in 1alpha,19,25-trihydroxy-10,19-dihydrovitamin D3 derivatives in which the hydroxymethyl substituent at C-10, for steric reasons, is forced to occupy an axial position. In consequence, the vitamin D3 analogues were synthesized in which the 1alpha-hydroxy group, required for biological activity, is almost exclusively axially or equatorially oriented because of stabilization of the single A-ring chair conformations. The relative ability of the synthesized analogues to bind the porcine intestinal vitamin D receptor was assessed and compared with that of the natural hormone. It was established that vitamins possessing the axial orientation of the 1alpha-hydroxy substituent exhibit a significantly increased receptor binding affinity. Compounds with a 2-methylene substituent showed selective calcemic activity profiles, being extremely effective on bone calcium mobilization. 2alpha-Methyl-substituted vitamins proved to be much more active in vivo than the corresponding epimers with 2beta-configuration. All of the 2-substituted vitamins exhibited pronounced HL-60 differentiating activity, those 2alpha-substituted in the 20S-series being especially potent. The present studies imply that the axial orientation of the 1alpha-hydroxy group is necessary for biological activity of vitamin D compounds.

Animals↗
PubMed1998

Combinational effects of vitamin D3 and retinoic acid (all trans and 9 cis) on proliferation, differentiation, and programmed cell death in two small cell lung carcinoma cell lines.

The effects of a combination of vitamin D3 [1,25(OH)2D3] and retinoic acid (RA) on proliferation, differentiation, and apoptosis of the human small cell lung carcinoma (SCLC) cell lines NCI-H82 and NCI-H209 were evaluated. Cell proliferation was inhibited by 1,25(OH)2D3 and RA alone. The combination of 1,25(OH)2D3 and the cis form of retinoic acid resulted in an additive decrease in cell proliferation and the induction of apoptosis in various concentrations. Moreover, 3H-thymidine incorporation was inhibited and the number of viable cells was decreased. The characteristics of the apoptotic cells were examined and confirmed by morphologic analysis, light and electron microscopy, and fluorescence detection. It was concluded that 1,25(OH)2D3 and RA exert additive effects on the inhibition of proliferation and the induction of apoptosis in both the NCI-H82 and the NCI-H209 SCLC cell lines. This finding has important implications for the use of retinoids and 1,25(OH)2D3 in cancer prevention and in the therapy of small cell lung carcinoma.

Alitretinoin↗
PubMed1998

Inhibition of 25-hydroxyvitamin D3 production by 1, 25-dihydroxyvitamin D3 in rats.

The regulation of the hepatic vitamin D3 25-hydroxylase enzyme system by 1,25-dihydroxyvitamin D3 was examined using male rats. Circulating 25-hydroxyvitamin D3 levels decreased in response to increasing doses of 1,25-dihydroxyvitamin D3 as determined by HPLC and serum protein binding assay. A maximum reduction in serum 25-hydroxyvitamin D3 of 57.7% was achieved by the administration of 1,25-dihydroxyvitamin D3 and higher doses produced no further reduction. The in vitro rate of vitamin D 25-hydroxylation by liver homogenates from rats given 1,25-dihydroxyvitamin D3 was also reduced by 60.4%. Whole rat extracts from animals given [3H]vitamin D3 contained 50.4% less 25-[3H]hydroxyvitamin D3 in treated rats given 1,25-dihydroxyvitamin D3 than in those given only the vehicle. Further, 1,25-dihydroxyvitamin D3 treatment had no effect on in vivo disappearance of 25-[3H]hydroxyvitamin D3. Taken together, these results demonstrate that the decrease in 25-hydroxyvitamin D3 levels observed in 1,25-dihydroxyvitamin D3-treated rats results from a decrease in production and not an increase in the metabolic clearance of 25-[3H]hydroxyvitamin D3.

25-Hydroxyvitamin D3 1-alpha-Hydroxylase↗