Search PubMed⌕ Search

Biomedical subjects

H B Tanowitz

Publications and source records attributed to H B Tanowitz.

At least 19 recordsLinked to original sources
PubMed1992

Trypanosoma cruzi: stage expression of calmodulin-binding proteins.

The subcellular distribution of calmodulin-binding proteins in three life stages of Trypanosoma cruzi was analyzed by a [125I]calmodulin gel overlay procedure under conditions where proteolysis was kept to a minimum. It was found that T. cruzi contains a complex profile of calcium-dependent calmodulin-binding proteins and that several of these polypeptides were differentially expressed at specific stages of development. The majority of these stage-specific polypeptides was found in the particulate fractions of the replicative stages of the parasite, i.e., epimastigote and amastigote. These studies suggest that calcium and calmodulin may play an important central role in the growth and differentiation of this parasite. We have also assessed the calmodulin content of the various life stages by immunoblot analysis. These studies identified a 14-kDa immunoreactive peptide present at equivalent levels in epi-, trypo-, and amastigote stages (extracellular).

Animals↗
PubMed1992

Trypanosoma cruzi: mechanisms of intracellular calcium homeostasis.

Regulation of intracellular Ca2+ homeostasis was characterized in epimastigote forms of Trypanosoma cruzi using the fluorescence probe Fura-2. Despite an increase in extracellular Ca2+, [Ca2+]o, from 0 to 2 mM, cytosolic Ca2+, [Ca2+]i, increased only from 85 +/- 9 to 185 +/- 21 nM, indicating the presence of highly efficient mechanisms for maintaining [Ca2+]i. Exposure to monovalent Na+ (monensin)-, K+ (valinomycin, nigericin)-, and divalent Ca2+ (ionomycin)-specific ionophores, uncouplers of mitochondrial respiration (oligomycin), inhibitors of Na+/K(+)-ATPase (ouabain), and Ca(2+)-sensitive ATPase (orthovanadate) in 0 or 1 mM [Ca2+]o resulted in perturbations of [Ca2+]i, the patterns of which suggested both sequestration and extrusion mechanisms. Following equilibration in 1 mM [Ca2+]o, incubation with orthovanadate markedly increased [Ca2+]i, results which are compatible with an active uptake of [Ca2+]i by endoplasmic reticulum. In contrast, equilibration in 0 or 1 mM [Ca2+]o did not influence the relatively smaller increase in [Ca2+]i following incubation with oligomycin, suggesting a minor role for the mitochondrial compartment. In cells previously equilibrated in 1 mM [Ca2+]o, exposure to monensin or ouabain, conditions known to decrease the [Na+]o/[Na+]i gradient, upon which the Na+/Ca2+ exchange pathways are dependent, markedly increased [Ca2+]i. In a complementary manner, decreasing the extracellular Na+ gradient with Li+ increased [Ca2+]i in a dose-dependent manner. Finally, the calcium channel blockers verapamil and isradipine inhibited the uptake of Ca2+ by greater than 50%, whereas diltiazem, nifedipine, and nicardipine were ineffective. The results suggest that epimastigote forms of T. cruzi maintain [Ca2+]i by uptake, sequestration, and extrusion mechanisms, with properties common to eukaryotic organisms.

Animals↗
PubMed1992

Intestinal parasites in returned travelers.

Travelers returning from third-world countries may become infected with a variety of intestinal parasites. Although protozoan infections are more frequently seen, intestinal worms are also encountered. If considered in the differential diagnosis, these infections usually are readily diagnosed and treated.

Humans↗
PubMed1992

Imported malaria in the Bronx: review of 51 cases recorded from 1986 to 1991.

The cases of 51 patients with malaria seen at the Albert Einstein College of Medicine hospitals from January 1986 to June 1991 are reviewed. Thirty-five patients acquired infection on journeys to their country of origin. Of these 35 patients, 83% of whom had lived in the United States for > or = 2 years, only 17% received antimalarial prophylaxis. Ten of the 51 patients were born and raised in the United States, and 70% received prophylaxis (P < .01). Six of the 51 patients were visitors to the United States from areas endemic for malaria. Overall, 64% of patients acquired malaria in West Africa, south of the Sahara; 20% in Asia; 8% in Ecuador; 6% in Haiti; and 4% in the Middle East. The majority of infections were due to Plasmodium falciparum. Six patients traveled to a zone endemic for malaria while pregnant, and none received prophylaxis. In nine of 13 patients who received prophylaxis, there was inadequate dosing or poor compliance. Individuals born in regions endemic for malaria are at high risk of acquiring malaria on return to their countries of origin and are less aware of the need for malaria prophylaxis than are other travelers.

Adolescent↗
PubMed1992

Cytokine gene expression of endothelial cells infected with Trypanosoma cruzi.

Coronary microvascular spasm and platelet hyperreactivity have been implicated in the pathogenesis of Chagas' cardiomyopathy. To clarify further the role of the microvasculature in this disease, alterations in cytokine gene expression due to Trypanosoma cruzi infection of human umbilical vein endothelial cells were examined. Northern blot analysis of total RNA from endothelial cells demonstrated that interleukin (IL)-1 beta, IL-6, and colony-stimulating factor 1 (CSF-1) mRNA expression was absent or minimal in uninfected cells but significantly increased in infected cells. c-sis mRNA levels diminished with increased time of infection. In situ hybridization studies also demonstrated high levels of IL-6 mRNA in individual infected cells. Significant levels of IL-6 and IL-1 beta protein were detected in the supernatants of infected endothelial cells. The serum of an acutely infected individual contained high levels of IL-6 protein, suggesting the potential importance of cytokines secreted by the vascular endothelium in the pathogenesis of Chagas' cardiomyopathy.

Animals↗
PubMed1992

Chagas' disease.

Chagas' disease, caused by Trypanosoma cruzi, is an important cause of morbidity in many countries in Latin America. The important modes of transmission are by the bite of the reduviid bug and blood transfusion. The organism exists in three morphological forms: trypomastigotes, amastigotes, and epimastigotes. The mechanism of transformation and differentiation is currently being explored, and signal transduction pathways of the parasites may be involved in this process. Parasite adherence to and invasion of host cells is a complex process involving complement, phospholipase, penetrin, neuraminidase, and hemolysin. Two clinical forms of the disease are recognized, acute and chronic. During the acute stage pathological damage is related to the presence of the parasite, whereas in the chronic stage few parasites are found. In recent years the roles of tumor necrosis factor, gamma interferon, and the interleukins in the pathogenesis of this infection have been reported. The common manifestations of chronic cardiomyopathy are arrhythmias and thromboembolic events. Autoimmune, neurogenic, and microvascular factors may be important in the pathogenesis of the cardiomyopathy. The gastrointestinal tract is another important target, and "mega syndromes" are common manifestations. The diagnosis and treatment of this infection are active areas of investigation. New serological and molecular biological techniques have improved the diagnosis of chronic infection. Exacerbations of T. cruzi infection have been reported for patients receiving immuno-suppressive therapy and for those with AIDS.

Animals↗
PubMed1992

Gap junction distribution is altered between cardiac myocytes infected with Trypanosoma cruzi.

Conduction disturbances frequently accompany both acute and chronic Chagas' disease. To explore the possibility that changes in gap junction distribution or abundance might play a role in these disturbances, we have investigated intercellular communication between rat neonatal cardiac myocytes in cultures infected with Trypanosoma cruzi. Contractile activity of infected cells was characterized by regional asynchrony within the culture as well as by irregular contraction patterns. Junctional conductance between infected cell pairs was found to be significantly lower than in uninfected cell pairs, and the rapidity and extent of intercellular transfer of the dye lucifer yellow was markedly reduced between infected cells. Immunocytochemical studies demonstrated that the parasitic infection significantly decreased connexin43 expression at junctional membrane regions, correlating with the detected functional uncoupling. These findings of reduced gap junction abundance and function in trypanosome-infected cells may provide important insight into the pathogenesis of the cardiac arrhythmias that attend Chagas' disease.

Animals↗
PubMed1992

Pyrimethamine concentrations in serum during treatment of acute murine experimental toxoplasmosis.

Central nervous system toxoplasmosis is a major opportunistic infection in patients with acquired immunodeficiency syndrome. The standard therapy for this infection is pyrimethamine (PYR) and sulfonamides. To assess in vivo if PYR alone could adequately treat toxoplasmosis, a murine model of acute toxoplasmosis was used. The CD1 strain of mice was infected intraperitoneally with 10(4) parasites of the RH strain of Toxoplasma gondii. Pyrimethamine was administered in mouse chow at concentrations of 0, 0.03125, 0.0625, 0.125, 0.25, or 1.0 mg of PYR/g of food, which provides the following daily PYR dosages: 0, 6.25, 12.5, 25, 50, and 200 mg/kg/day. No sulfonamides were administered. Serum PYR levels proved more accurate than mg of PYR/g of food in predicting survival. Mice with serum PYR levels greater than or equal to 500 ng/ml (2 microM) survived and had no parasites present on peritoneal lavage. Mice with serum PYR levels less than 100 ng/ml (0.4 microM) had a 100% mortality rate and the average parasite count was 3 x 10(7) organisms in the lavage fluid. At a PYR level of 370 ng/ml, six of 11 mice survived and the lavage fluid contained 2.5 x 10(5) organisms. Previously, using 3H-uracil in an in vitro assay, PYR at a concentration of 500 ng/ml was shown to be as effective in inhibiting Toxoplasma growth as the combination of PYR (100 ng/ml) and sulfonamides 25 micrograms/ml). These data suggest the potential usefulness of PYR for monotherapy of toxoplasmosis and are consistent with previously described in vitro assays.

Acute Disease↗
PubMed1992

Blastocystis hominis in hospital employees.

Several reports have appeared that either support or deny the importance of the protozoan Blastocystis hominis as an intestinal pathogen in humans. In this report, we describe the clinical characteristics of B. hominis and its response to therapy in hospital employees found to have the parasite on routine screening of stools. During the study, 49 patients with B. hominis were identified, and 413 stools were examined from these patients. Twenty-nine patients were asymptomatic (59%), and 20 had symptoms of bloating, flatulence, soft/loose stools, or constipation. Of these 20 patients, 10 had symptoms that correlated with the presence or absence of B. hominis, four had symptoms that were independent of B. homonis, and six had other intestinal parasites that could account for their symptoms. Nineteen percent of patients without treatment had eradication of B. hominis from stool on follow-up examination. Metronidazole did not increase this rate. Iodoquinol treatment eradicated the organism in 41% of patients (p less than 0.05), and resulted in the reduction or eradication of the parasite in 62%, as determined by follow-up examination.

Adolescent↗
PubMed1992

Medical management of AIDS patients. Gastrointestinal manifestations.

Gastrointestinal manifestations of AIDS are common. Opportunistic infections and tumors may affect any portion of the GI tract from oral cavity to anus. Esophageal involvement may result from Candida, CMV, HSV, HIV, and tumors. Biliary tract and pancreatic disease may cause abdominal pain. Diarrhea occurs in over 50% of AIDS patients and is multifactorial.

Abdominal Pain↗
PubMed1991

Light microscopic diagnosis of human microsporidiosis and variable response to octreotide.

Microsporida are protozoan parasites that have recently been identified as a cause of human disease in immunocompromised patients. Because of their small size, they have been recognized primarily by electron microscopy. This has limited the study of their prevalence, incidence, and association with large-volume diarrhea. The present report describes two cases of Enterocytozoon bieneusi infection of the small intestine in patients with intractable diarrhea in whom the diagnosis was made by light microscopy and confirmed by electron microscopy. Both patients were treated with octreotide, and one had a good response.

Acquired Immunodeficiency Syndrome↗
PubMed1991

Sensitive and specific detection of toxoplasma DNA in an experimental murine model: use of Toxoplasma gondii-specific cDNA and the polymerase chain reaction.

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is well recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PCR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5'CACACGGTTGTATGTCGGTTTCGCT3' and 5'TCAAGGAGCTCAATGTTACAGCCT3' followed by oligonucleotide hybridization using 5'GCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCA3' allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.

Animals↗
PubMed1991

Resolution of Cryptosporidium infection in an AIDS patient after improvement of nutritional and immune status with octreotide.

An AIDS patient with severe large volume diarrhea and malnutrition due to cryptosporidial infection is presented. The patient, who was not receiving zidovudine, was treated with octreotide with resolution of diarrhea leading to improvement in nutritional status, immune functions, and subsequently, resolution of the Cryptosporidium infection. This case points out the need for adequate nutrition in AIDS patients and highlights the relationship of nutrition and the immune system.

Acquired Immunodeficiency Syndrome↗
PubMed1990

Disseminated strongyloidiasis with central nervous system involvement diagnosed antemortem in a patient with acquired immunodeficiency syndrome and Burkitts lymphoma.

A 45-year-old man presented with central nervous system involvement as the initial manifestation of disseminated infection with Strongyloides stercoralis. Several concurrent clinical factors contributed to this event, all related to the patient's immunosuppression, including high-grade lymphoma, corticosteroid therapy, and acquired immunodeficiency syndrome. This is only the third case of CNS involvement in disseminated strongyloidiasis diagnosed antemortem.

Acquired Immunodeficiency Syndrome↗
PubMed1990

Extracellular matrix derived from Trypanosoma cruzi infected endothelial cells directs phenotypic expression.

Infection of confluent human umbilical vein endothelial cells by the parasite Trypanosoma cruzi results in the appearance of an altered heparan sulfate proteoglycan (HSPG) isolated from the extracellular matrix of infected endothelial cells (ECMi). HSPG from ECMi differed from HSPG obtained from the extracellular matrix of uninfected endothelial cells (ECMu) by virtue of an 8-10-fold increase in sulfation and a different elution pattern using DEAE Sepharose chromatography. Analysis of the HSPG that binds to acidic fibroblast growth factor (aFGF) revealed that infection increased the proportion of HSPG that binds to aFGF by 35%. Heparitinase and alkaline borohydride treatment of aFGF-binding HSPG and chromatographic resolution on Sepharose CL4B column revealed an infection-associated 10-fold increase in sulfation of the GAG side chain with no significant change in the migration of the core protein. In addition, the aFGF binding HSPG isolated from ECMi demonstrated a markedly attenuated synergistic mitogenic activity with aFGF in a cell proliferation assay. All of the infection associated changes in HSPG could be demonstrated in HSPG obtained from uninfected endothelial cell cultures grown on ECMi. Hence, the ECMi is associated with signals capable of modulating the ECM associated metabolism of uninfected endothelial cells. This facility of ECMi was also shown to extend to patterns of Gs protein synthesis as revealed by Western blot analysis. The observation that the ECM produced by infected endothelial cells can direct the synthetic patterns of uninfected endothelial cells in a manner uniquely observed in infected endothelial cells suggests a plausible pathway by which infection of only a few cells can ultimately result in the coordinate responses of neighboring uninfected cells.

Chagas Disease↗
PubMed1990

Pathophysiological insights into the cardiomyopathy of Chagas' disease.

The evidence gained from both human and animal studies of chronic chagasic cardiomyopathy suggests that the disease occurs as a consequence of several discrete and progressive pathophysiological processes occurring after infection, the ultimate expression of which depends on a host of unidentified factors. Collectively, the infection-associated events compromise microvasculature function and result in hypoperfusion, with consequences indistinguishable from those observed in other, nonparasitological cardiomyopathic diseases secondary to hypoperfusion. Therefore, chronic chagasic cardiomyopathy may share similar pathophysiological abnormalities with other chronic congestive cardiomyopathic states.

Animals↗