Biomedical subjects

Gary N Parkinson

Publications and source records attributed to Gary N Parkinson.

11 recordsLinked to original sources

PubMed2006

Quadruplex DNA: sequence, topology and structure.

G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and biological validation of these structures is starting to be explored, and there is particular interest in them as targets for therapeutic intervention. This survey focuses on the folding and structural features on quadruplexes formed from telomeric and non-telomeric DNA sequences, and examines fundamental aspects of topology and the emerging relationships with sequence. Emphasis is placed on information from the high-resolution methods of X-ray crystallography and NMR, and their scope and current limitations are discussed. Such information, together with biological insights, will be important for the discovery of drugs targeting quadruplexes from particular genes.

Animals↗

PubMed2006

Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex.

The topology of DNA quadruplexes depends on the nature and number of the nucleotides linking G-quartet motifs. To assess the effects of a three-nucleotide TTT linker, the crystal structure of the DNA sequence d(G(4)T(3)G(4)) has been determined at 1.5 A resolution, together with that of the brominated analogue d(G(4)(Br)UTTG(4)) at 2.4 A resolution. Both sequences form bimolecular intermolecular G-quadruplexes with lateral loops. d(G(4)(Br)UTTG(4)) crystallized in the monoclinic space group P2(1) with three quadruplex molecules in the asymmetric unit, two associating together as a head-to-head stacked dimer, and the third as a single head-to-tail dimer. The head-to-head dimers have two lateral loops on the same G-quadruplex face and form an eight-G-quartet stack, with a linear array of seven K(+) ions between the quartets. d(G(4)T(3)G(4)) crystallized in the orthorhombic space group C222 and has a structure very similar to the head-to-tail dimer in the P2(1) unit cell. The sequence studied here is able to form several different folds; however, all four quadruplexes in the two structures have lateral loops, in contrast to the diagonal loops reported for the analogous quadruplex with T(4) loops. A total of seven independent T(3) loops were observed in the two structures. These can be classified into two discrete conformational classes, suggesting that these represent preferred loop conformations that are independent of crystal-packing forces.

Crystallization↗

PubMed2006

Predictive modelling of topology and loop variations in dimeric DNA quadruplex structures.

We have used a combination of simulated annealing (SA), molecular dynamics (MD) and locally enhanced sampling (LES) methods in order to predict the favourable topologies and loop conformations of dimeric DNA quadruplexes with T2 or T3 loops. This follows on from our previous MD simulation studies on the influence of loop lengths on the topology of intramolecular quadruplex structures [P. Hazel et al. (2004) J. Am. Chem. Soc., 126, 16 405-16 415], which provided results consistent with biophysical data. The recent crystal structures of d(G4T3G4)2 and d(G4BrUT2G4) (P. Hazel et al. (2006) J. Am. Chem. Soc., in press) and the NMR-determined topology of d(TG4T2G4T)2 [A.T. Phan et al. (2004) J. Mol. Biol., 338, 93-102] have been used in the present study for comparison with simulation results. These together with MM-PBSA free-energy calculations indicate that lateral T3 loops are favoured over diagonal loops, in accordance with the experimental structures; however, distinct loop conformations have been predicted to be favoured compared to those found experimentally. Several lateral and diagonal loop conformations have been found to be similar in energy. The simulations suggest an explanation for the distinct patterns of observed dimer topology for sequences with T3 and T2 loops, which depend on the loop lengths, rather than only on G-quartet stability.

Computer Simulation↗

PubMed2005

Out-of-shape DNA minor groove binders: induced fit interactions of heterocyclic dications with the DNA minor groove.

DB921 and DB911 are benzimidazole-biphenyl isomers with terminal charged amidines. DB911 has a central meta-substituted phenyl that gives it a shape similar to those of known minor groove binding compounds. DB921 has a central para-substituted phenyl with a linear conformation that lacks the appropriate radius of curvature to match the groove shape. It is thus expected that DB911, but not DB921, should be an effective minor groove binder, but we find that DB921 not only binds in the groove but also has an unusually high binding constant in SPR experiments (2.9 x 10(8) M(-)(1), vs 2.1 x 10(7) M(-)(1) for DB911). ITC thermodynamic analysis with an AATT sequence shows that the stronger binding of DB921 is due to a more favorable binding enthalpy relative to that of DB911. CD results support minor groove binding for both compounds but do not provide an explanation for the binding of DB921. X-ray crystallographic analysis of DB921 bound to AATT shows that an induced fit structural change in DB921 reduces the twist of the biphenyl to complement the groove, and places the functional groups in position to interact with bases at the floor of the groove. The phenylamidine of DB921 forms indirect contacts with the bases through a bound water. The DB921-water pair forms a curved binding module that matches the shape of the minor groove and provides a number of strong interactions that are not possible with DB911. This result suggests that traditional views of compound curvature required for minor groove complex formation should be reevaluated.

Amidines↗

PubMed2005

Targeting the DNA minor groove with fused ring dicationic compounds: comparison of in silico screening and a high-resolution crystal structure.

The crystal structure of the DNA minor groove biphenyl benzimidazole diamidine ligand DB819 has been determined, bound to the DNA sequence d(CGCGAATTCGCG)(2), at a resolution of 1.36 Angstrom. Conditions for reliable in silico docking that reproduce the observed position of the ligand in the minor groove have been determined.

Crystallography, X-Ray↗

PubMed2005

Putative DNA quadruplex formation within the human c-kit oncogene.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Base Sequence↗

PubMed2003

Studies on the nitroreductase prodrug-activating system. Crystal structures of complexes with the inhibitor dicoumarol and dinitrobenzamide prodrugs and of the enzyme active form.

The E. coli nitroreductase enzyme (NTR) has been widely used in suicide gene therapy (GDEPT and ADEPT) applications as a activating enzyme for nitroaromatic prodrugs of the dinitrobenzamide class. NTR has been previously shown to be a homodimeric enzyme with two active sites. We present here the crystal structures of the reduced form of NTR and its complexes with the inhibitor dicoumarol and three dinitrobenzamide prodrugs. Comparison of the structures of the oxidized and reduced forms of the native enzyme shows that the principal structural changes occur in the FMN cofactor and indicate that the enzyme itself is a relatively rigid structure that primarily provides a rigid structural framework on which hydride transfer occurs. The aziridinyldinitrobenzamide prodrug CB 1954 binds in nonidentical ways in both of the two active sites of the homodimeric enzyme, employing both hydrophobic and (in active site B) a direct H-bond contact to the side chain of Lys14. In active site A the 2-nitro group stacks above the FMN, and in active site B the 4-nitro group does, explaining why reduction of either nitro group is observed. In contrast, the larger mustard group of the dinitrobenzamide mustard compound SN 23862 forces the prodrug to bind at both active sites with only the 2-nitro group able to participate in hydride transfer from the FMN, explaining why only the 2-hydroxylamine reduction product is observed. In each site, the nitro groups of the prodrug make direct H-bond contacts with the enzyme; in active Site A the 2-nitro to Ser40 and the 4-nitro to Asn71, while in active Site B the 2-nitro contacts the main chain nitrogen of Thr41 and the 4-nitro group the Lys14 side chain. The related amide-substituted mustard SN 27217 binds in a broadly similar fashion, but with the larger amide group substituent able to reach and contact the side chain of Arg107, further restricting the prodrug conformations in the binding site. The inhibitor dicoumarol appears to bind primarily by pi-stacking interactions and hydrophobic contacts, with no conformational changes in the enzyme. One of the hydroxycoumarin subunits stacks above the plane of the FMN via pi-overlap with the isoalloxazine ring, penetrating deep into the groove, with the other less well-defined. These studies suggest guidelines for further prodrug design. Steric bulk (e.g., mustard rather than aziridine) on the ring can limit the possible binding orientations, and the reducible nitro group must be located para to the mustard. Substitution on the carboxamide side chain still allows the prodrugs to bind, but also limits their orientation in the binding site. Finally, modulating substrate specificity by alteration of the structure of the enzyme rather than the prodrug might usefully focus on modifying the Phe124 residue and those surrounding it.

Aniline Mustard↗

PubMed2003

Structure of a G-quadruplex-ligand complex.

Stabilisation of G-quadruplex structures formed from telomeric DNA, by means of quadruplex-selective ligands, is a means of inhibiting the telomerase enzyme from catalysing the synthesis of telomeric DNA repeats. In order to understand the molecular basis of ligand-quadruplex recognition, the crystal structure has been determined of such a complex, at 1.75A resolution. This complex is between a dimeric antiparallel G-quadruplex formed from the Oxytricha nova telomeric DNA sequence d(GGGGTTTTGGGG), and a di-substituted aminoalkylamido acridine compound. The structure shows that the acridine moiety is bound at one end of the stack of G-quartets, within one of the thymine loops. It is held in place by a combination of stacking interactions and specific hydrogen bonds with thymine bases. The stability of the ligand in this binding site has been confirmed by a 2ns molecular dynamics simulation.

Acridines↗

PubMed2003

The structure of telomeric DNA.

The telomere is a nucleoprotein complex located at the ends of eukaryotic chromosomes. It is essential for maintaining the integrity of the genome. It is not a linear structure and, for much of the cell cycle, telomeric DNA is maintained in a loop structure, which serves to protect the vulnerable ends of chromosomes. Many of the key proteins in the telomere have been identified, although their interplay is still imperfectly understood and structural data are only available on a few. Telomeric DNA itself comprises simple guanine-rich repeats for most of its length, culminating in a short overhang of single-stranded sequence at the extreme 3' ends. This can, at least in vitro, fold into a wide variety of four-stranded quadruplex structures, many of whose arrangements are being revealed by crystallographic and NMR studies.

DNA↗

PubMed2002

Crystal structure of the potassium form of an Oxytricha nova G-quadruplex.

The crystal structures of the potassium-containing quadruplex formed from the Oxytricha nova sequence d(GGGGTTTTGGGG) are reported, in two space groups, the orthorhombic P2(1)2(1)2(1) and the trigonal P3(2)21, which diffract to 2.0 A and 1.49 A, respectively. The orthorhombic form contains two independent quadruplexes in the asymmetric unit, and the trigonal form contains one. All three of these quadruplexes adopt an identical fold, with two strands forming an antiparallel diagonal arrangement. This is identical with that observed previously in NMR studies of the native sodium and potassium forms, and a crystallographic analysis of it complexed with an O. nova protein. The present analysis demonstrates that the native structure is the same in solution and in the crystalline state and, moreover, that the nature of the counter-ion does not affect the overall fold of this quadruplex. The analysis corrects an earlier crystallographic study of this quadruplex. The conformation of the tetra-thymine loop is described in detail, which involves the third thymine base folding back to interact with the first thymine base. The water networks in the grooves and loops are described and, in particular, the ability of water molecules to form a continuous spine of hydration in the narrow groove is detailed. Each quadruplex has five potassium ions organised in a linear channel, with square antiprismatic coordination to each ion from oxygen atoms.

Animals↗

PubMed2002

Crystal structure of parallel quadruplexes from human telomeric DNA.

Telomeric ends of chromosomes, which comprise noncoding repeat sequences of guanine-rich DNA, are fundamental in protecting the cell from recombination and degradation. Disruption of telomere maintenance leads to eventual cell death, which can be exploited for therapeutic intervention in cancer. Telomeric DNA sequences can form four-stranded (quadruplex) structures, which may be involved in the structure of telomere ends. Here we describe the crystal structure of a quadruplex formed from four consecutive human telomeric DNA repeats and grown at a K(+) concentration that approximates its intracellular concentration. K(+) ions are observed in the structure. The folding and appearance of the DNA in this intramolecular quadruplex is fundamentally different from the published Na(+)-containing quadruplex structures. All four DNA strands are parallel, with the three linking trinucleotide loops positioned on the exterior of the quadruplex core, in a propeller-like arrangement. The adenine in each TTA linking trinucleotide loop is swung back so that it intercalates between the two thymines. This DNA structure suggests a straightforward path for telomere folding and unfolding, as well as ways in which it can recognize telomere-associated proteins.

Base Sequence↗