The thyrotropin receptor and the regulation of thyrocyte function and growth.
Explore the source record for details and available documents.
Animals↗
Biomedical subjects
G Vassart
Publications and source records attributed to G Vassart.
Binding assay for thyrotropin receptor autoantibodies using the recombinant receptor protein.
We have characterized a transfected Chinese hamster ovary cell line, JP09, which expresses high levels of the human TSH receptor (TSH-R). Based on a theoretical biological activity for TSH of 40 IU/mg, JP09 has approximately 90,000 receptors per cell, having a dissociation constant of 1.64 x 10(3) mU/L or 1.47 x 10(-9) mol/L. We have used JP09 to prepare solubilized TSH-Rs which have formed the basis of a binding assay for thyroid-binding inhibiting immunoglobulins in unfractionated sera. We have compared the JP09 assay with the TRAK assay (which is based on solubilized porcine TSH-R) and found a highly positive correlation between the two assays, r = 0.83 P < 0.0001, in 55 sera from patients with autoimmune thyroid disease. JP09 can be adapted to growth in suspension culture, permitting large scale production. The tracer in the assay is bovine [125I]TSH; surprisingly, despite the use of a hTSH-R, hTSH had no effect on the binding of the tracer up to 10(3) mU/L and only a minor effect at 10(4) mU/L.
Animals↗
Leber's hereditary optic neuropathy: clinical and molecular genetic aspects. Preliminary results in our families.
Leber's hereditary optic neuropathy (LHON) is a genetic maternally transmitted disorder characterised by sudden bilateral loss of vision. The discovery of at least one mitochondrial DNA mutation associated with the disease has provided the basis for a molecular diagnosis in about 50% of families with LHON. We present a brief review of the clinical and molecular genetic aspects of LHON along with our results in 13 patients.
Adolescent↗
[G-protein-binding receptors].
All G protein-binding receptors have closely similar structures. They all include seven membrane-spanning segments, with significant sequence homologies between receptors. G. Vassart and co-workers made use of this fact to devise a polymerase chain reaction (PCR) method for cloning G protein-binding receptors. This method has been used to sequence a large number of hormone receptors including the thyrotropin (TSH) receptor. The process used to isolate this receptor is described, as well as newly gained insights into the pathophysiology of autoimmune thyroid gland diseases. For some sequenced receptors, the natural ligands were not known. This required development of strategies designed at identifying the functions of these receptors. An illustrative example of this approach is the characterization of A1 and A2 receptors for adenosine.
Cloning, Molecular↗
The orphan receptor cDNA RDC4 encodes a 5-HT1D serotonin receptor.
The cDNA of RDC4, a putative receptor of the G protein-coupled receptor family, has been cloned by PCR methodology. The primary structure of this receptor showed homology with the serotonin 5-HT1A receptor. In this work, RDC4 mRNA has been injected in Y1 adrenal cells and Xenopus oocytes and RDC4 cDNA has been transfected transiently in cos-7 cells. In all these systems serotonin elicited a rise in cyclic AMP levels. Binding studies on membranes of the transfected cos-7 cells using [3H]-LSD showed a pattern of drug affinities consistent with the known properties of a 5-HT1D receptor. RDC4 therefore codes for a 5-HT1D receptor which in the studied systems is positively coupled to adenylate cyclase.
8-Hydroxy-2-(di-n-propylamino)tetralin↗
Isolation and characterization of the canine thyroglobulin gene promoter region.
The 5' flanking sequences from the canine thyroglobulin gene were isolated by homology screening with the evolutionary conserved sequence from the bovine thyroglobulin promoter and sequenced. Transient expression in primary cultured dog thyrocytes demonstrated that the canine clone contains a functional promoter inducible by cAMP. DNAse I footprinting assays showed that the thyroid-specific transcription factor TTF-1, purified from bovine thyroid, also recognizes the canine thyroglobulin promoter. Similar footprints were obtained with crude nuclear extracts from primary cultured dog thyrocytes.
Animals↗
Molecular cloning of a human cannabinoid receptor which is also expressed in testis.
A cDNA clone encoding a receptor protein which presents all the characteristics of a guanine-nucleotide-binding protein (G-protein)-coupled receptor was isolated from a human brain stem cDNA library. The probe used (HGMP08) was a 600 bp DNA fragment amplified by a low-stringency PCR, using human genomic DNA as template and degenerate oligonucleotide primers corresponding to conserved sequences amongst the known G-protein-coupled receptors. The deduced amino acid sequence encodes a protein of 472 residues which shares 97.3% identity with the rat cannabinoid receptor cloned recently [Matsuda, Lolait, Brownstein, Young & Bronner (1990) Nature (London) 346, 561-564]. Abundant transcripts were detected in the brain, as expected, but lower amounts were also found in the testis. The same probe was used to screen a human testis cDNA library. The cDNA clones obtained were partially sequenced, demonstrating the identity of the cannabinoid receptors expressed in both tissues. Specific binding of the synthetic cannabinoid ligand [3H]CP55940 was observed on membranes from Cos-7 cells transfected with the recombinant receptor clone. In stably transfected CHO-K1 cell lines, cannabinoid agonists mediated a dose-dependent and stereoselective inhibition of forskolin-induced cyclic AMP accumulation. The ability to express the human cannabinoid receptor in mammalian cells should help in developing more selective drugs, and should facilitate the search for the endogenous cannabinoid ligand(s).
Amino Acid Sequence↗
Manic-depression locus on X chromosome.
Explore the source record for details and available documents.
Bipolar Disorder↗
Distribution of adenosine A2 receptor mRNA in the human brain.
The distribution of the messenger RNA coding for the recently cloned adenosine A2 receptor was studied in the human brain using in situ hybridization histochemistry. A2 receptor mRNA is exclusively detected in the medium-sized neurons of the caudate, putamen and accumbens nuclei but not elsewhere in the brain. This highly selective distribution of adenosine A2 receptor mRNA in human dorsal and ventral striatum, similar to that of adenosine A2 binding sites reported in rodents, suggests a major role in the basal ganglia physiology.
Adult↗
Cloning and sequence analysis of TFE, a helix-loop-helix transcription factor able to recognize the thyroglobulin gene promoter in vitro.
A cDNA that encodes a transcription factor able to recognize the thyroglobulin gene promoter in vitro was isolated from a dog thyroid cDNA expression library in lambda gt11. The library was screened with a multimerized 20 bp-oligonucleotide probe corresponding to the -126 to -107 bp region of the bovine thyroglobulin gene promoter. The specificity of DNA sequence recognition was demonstrated by DNA binding experiments realized with beta-galactosidase-fusion protein immobilized on nitrocellulose filters and various unlabelled multimerized competing DNA fragments. The encoded protein, TFE, appears to be the canine counterpart of a recently cloned human transcription factor, ITF-2, that binds to the mu E5 kappa E2 motif found in both immunoglobulin heavy and light chains genes enhancers and belongs to the basic-Helix-Loop-Helix family of transcription factors. When TFE protein was produced in a rabbit reticulocyte lysate, it displayed the same specificity of DNA sequence recognition as the beta-galactosidase fusion protein and immobilization of the translation product on nitrocellulose still appeared to be essential for detecting in vitro DNA binding activity. Functional data failed to assign a role for TFE in the control of thyroglobulin gene transcription in vitro, suggesting that the selection of TFE clone resulted from the fortuitous presence of a high affinity binding site in the probe used for screening the expression library.
Amino Acid Sequence↗
The orphan receptor cDNA RDC7 encodes an A1 adenosine receptor.
The extensive amino acid sequence conservation among G protein-coupled receptors has been exploited to clone new members of this large family by homology screening or by PCR. Out of four such receptor cDNAs we cloned recently, RDC7 corresponds to a relatively abundant transcript in the brain cortex, the thyroid follicular cell and the testis. We have now identified RDC7 as an A1 adenosine receptor. The A1 agonist CPA [N6-cyclopentyladenosine] decreased by 80% cAMP accumulation in forskolin-stimulated CHO cells stably transfected with RDC7. Specific binding of another A1 adenosine agonist, [3H]CHA [N6-cyclohexyladenosine], was demonstrated on membranes from Cos cells transfected with a pSVL construct harbouring the RDC7 cDNA insert. The binding characteristics were similar to those of the natural brain A1 receptor. The recombinant and the natural receptors behaved also in the same way in displacement experiments involving a series of A1 adenosine agonists. The binding characteristics of RDC7 were compared to those of RDC8, another orphan receptor recently identified as an A2 adenosine receptor. The two molecular species RDC7 and RDC8 correspond clearly to the A1 and A2 receptor entities defined hitherto on a purely pharmacological basis.
Adenosine↗
Prevalence of the major mutation of the CF gene in Belgian patients.
Explore the source record for details and available documents.
Belgium↗
Human thyrotropin receptor gene: expression in thyroid tumors and correlation to markers of thyroid differentiation and dedifferentiation.
Human thyrotropin (TSH) receptor steady-state transcript levels were analyzed by Northern blot analysis in thyroids of patients with thyroid carcinoma, with hyperfunctioning adenoma and in normal controls. In control tissue and benign tumors expression levels of TSH receptor mRNA were high whereas in anaplastic carcinomas no normal TSH receptor mRNA was detected. In papillary and follicular tumors it varied from normal to markedly reduced levels. Thyroid peroxidase (TPO) and thyroglobulin (Tg) mRNA were strongly expressed in normal tissue and in hyperfunctioning adenomas but were completely lost in all anaplastic tumors. In papillary tumors expression of TPO and Tg mRNA varied from normal to a complete loss of expression of either TPO, Tg or both. Tg and TPO steady-state expression did not correlate to TSH receptor transcript levels. C-myc mRNA was highly expressed in anaplastic carcinomas, very variable in normal controls and in differentiated thyroid tumors and low in hyperfunctioning adenomas. In summary, TSH receptor mRNA is persistently expressed in all differentiated thyroid tissues and tumors but lost in undifferentiated carcinomas. Its persistence far along the transformation pathway further supports the concept that this gene which inserts the thyrocytes in the physiological regulatory network is almost constitutively expressed in this cell.
Adolescent↗
Follitropin receptor down-regulation involves a cAMP-dependent post-transcriptional decrease of receptor mRNA expression.
The regulation by FSH (follitropin; follicle-stimulating hormone) of FSH receptor mRNA and protein (FSH binding) was studied using cultured Sertoli cells isolated from 21-day-old rats. FSH induced a dose-dependent and almost complete down-regulation of receptor mRNA at 4 h after addition of the hormone. At subsequent time points (16 h and later) the FSH receptor mRNA levels had returned close to control values. The effect of FSH was mimicked by dibutyryl cyclic AMP (dbcAMP) and forskolin, and the phosphodiesterase inhibitor methyl-isobutylxanthine (MIX) prolonged the FSH action. These findings indicate that the effect of FSH on its receptor mRNA was mediated by cAMP. A down-regulatory effect of FSH and dbcAMP on FSH receptor mRNA was also observed in the presence of the protein synthesis inhibitor cycloheximide, suggesting a direct effect of FSH/dbcAMP on the expression of the FSH receptor gene. Transcriptional run-on experiments revealed that FSH did not inhibit initiation of the FSH receptor gene; hence a post-transcriptional mechanism is involved. Binding of 125I-FSH to the cultured Sertoli cells was rapidly (4 h) decreased when the cells were incubated with FSH or FSH in combination with MIX. This effect can be explained by ligand-induced receptor sequestration. In contrast, incubation of Sertoli cells with dbcAMP had no effect on binding of 125I-FSH after 4 h, but resulted in a 60% loss of FSH binding sites after 24 h, probably caused by decreased mRNA expression. In conclusion, FSH receptor down-regulation in Sertoli cells is effected not only by the well-documented ligand-induced loss of receptors from the plasma membrane, but also involves a cAMP-mediated decrease of FSH receptor mRNA through a post-transcriptional mechanism.
1-Methyl-3-isobutylxanthine↗
A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.
A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.
Base Sequence↗
Chromosomal mapping of A1 and A2 adenosine receptors, VIP receptor, and a new subtype of serotonin receptor.
cDNA clones encoding four new receptors of the G-protein-coupled receptor family were obtained by selective amplification and cloning from thyroid cDNA and termed RDC1, RDC4, RDC7, and RDC8. RDC7 and RDC8 have recently been identified as A1 and A2 adenosine receptors, respectively. These cDNAs were utilized for chromosomal in situ hybridization to establish the genomic location of the corresponding genes in man. The results indicate that human RDC1, RDC4, RDC7, and RDC8 are in regions 2q37, 1p34.3-1p36.3, 22q11.2-22q13.1, and 11q11-11q13, respectively.
Chromosome Banding↗
Current developments in G-protein-coupled receptors.
The rate at which receptors have been cloned has recently increased dramatically--existing families have been extended and new families created. The rapid cloning by homology of 'orphan receptors' has also stimulated the development of a new reverse pharmacology.
Animals↗
The human calbindin D28k (CALB1) and calretinin (CALB2) genes are located at 8q21.3----q22.1 and 16q22----q23, respectively, suggesting a common duplication with the carbonic anhydrase isozyme loci.
The genes encoding calbindin D28k (CALB1) and calretinin (CALB2), two closely related calcium-binding proteins, were mapped by in situ hybridization to the 8q21.3----q22.1 and 16q22----q23 regions of the human genome, respectively. These localizations match the chromosomal regions where the carbonic anhydrase isozyme gene cluster (CA1, CA2, CA3) and the related gene CA7 have been described, respectively. This suggests a common duplication o the calbindin/calretinin and the carbonic anhydrase ancestral genes.
Calbindin 1↗