Search PubMed⌕ Search

Biomedical subjects

G Tamura

Publications and source records attributed to G Tamura.

At least 235 records · Page 13Linked to original sources
PubMed1984

[A case with intramucosal carcinoma of the esophagus in widely expanding dysplasia--an autopsy case with simultaneous double-cancer of the esophagus and sigmoid colon].

Upon autopsy of a 67-year-old male who died of recurrence and metastasis from a carcinoma of the colon, early esophageal carcinoma was found. Diffuse slight thickening and longitudinal linear thinning with brownish discoloration were found in the esophageal mucosa. Upon microscopical examination, the esophageal epithelium showed mild dysplasia, severe dysplasia or intramucosal carcinoma. A diagram of the distribution of these lesions indicated that the carcinoma arose multicentrically in the lower two-third of the esophagus and always within, or adjacent to, the area of severe dysplasia.

Adenocarcinoma↗
PubMed1984

Substrate specificity of a new alkaline elastase from an alkalophilic bacillus.

The substrate specificity of alkaline elastase from alkalophilic Bacillus sp. Ya-B was studied by using a number of synthetic substrates. From the relative hydrolysis rate for p-nitrophenyl esters and t-butoxycarbonyl-L-Phe-L-Arg(NO2)-X-L-Phe-p-nitroanilide (X = L-Ala, Val, Leu, Ile, and Gly), the subsite S1 and S2 were concluded to be specific for L-alanine and glycine. The alkaline elastase rapidly hydrolyzed elastase specific substrate succinyl-L-Ala3-p-nitroanilide and succinyl-L-Ala-L-Pro-L-Ala-p-nitroanilide. These results prompted us to characterize our enzyme as a microbial elastase. Inhibition study with carbobenzoxy-L-Phe-chloromethyl ketone (ZPCK), Z-L-Ala-L-Phe-CK (ZAPCK), Z-L-Ala-Gly-L-Phe-CK (ZAGPCK), and kinetic study with succimyl-L-Ala2(3)-p-nitroanilide revealed that the enzyme has at least four subsites.

Bacillus↗
PubMed1983

Nucleotide sequence of the promoter and NH2-terminal signal peptide region of Bacillus subtilis alpha-amylase gene cloned in pUB110.

The nucleotide sequence of the promotor and NH2-terminal signal peptide region of the alpha-amylase gene derived from the alpha-amylase hyperproducing strain B. subtilis NA64 was determined. DNA sequences of the NH2-terminal region of the mature alpha-amylase, 41 amino acid residues of the signal peptide, a Shine-Dalgarno sequence (AGGAG), a potential RNA polymerase recognition site (TTGAAA), and a potential Pribnow box (AAGTAA) were identified. The DNA sequence was quite different from that of the alpha-amylase gene of B. amyloliquefaciens.

Amino Acid Sequence↗
PubMed1983

Spectrophotometric and electron spin resonance studies on the substrate interactions of ferredoxin-linked nitrite reductase from spinach.

Interactions of ferredoxin-linked nitrite reductase (NiR) from spinach with its substrate were studied by spectrophotometry and electron spin resonance (ESR) spectroscopy. Siroheme was extractable from NiR with 2.5% (W/V) trichloroacetic acid (TCA) and with acetone containing 0.01 N HCl. The addition of nitrite or sulfite to these extracts resulted in shifts of the absorption spectra of siroheme. The HCl-acetone extract showed ESR signals of symmetrical high spin heme, which disappeared on addition of nitrite. Spectral titration indicated a high affinity of extracted siroheme to nitrite and sulfite. The addition of nitrite or sulfite to protoheme dissolved in 0.01 N HCl-acetone did not cause a shift of the absorption spectrum. The extractability of siroheme with 0.01 N HCl-acetone was suppressed by the addition of nitrite to the NiR preparation. Moreover, a substrate-induced difference spectrum with peaks at about 295 and 287 nm was observed on addition of nitrite to NiR. These observations indicated an intrinsic strong affinity of siroheme to nitrite and sulfite, formation of rhombicity of siroheme by binding to the protein moiety, and also a probable conformational change of NiR on binding to the substrate. In agreement with previous reports, ESR signals of the heme-NO complex were observed with NiR in the presence of nitrite, methyl viologen (MV), and dithionite. In the present study, the same signals of similar intensity were also observed on omission of MV, under which conditions no catalytic reduction of nitrite occurred. Furthermore, the signal of the heme-NO complex was not observed when MV was replaced by spinach ferredoxin.(ABSTRACT TRUNCATED AT 250 WORDS)

Electron Spin Resonance Spectroscopy↗
PubMed1983

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.

Amino Acid Sequence↗
PubMed1983

The effect of adrenergic and cholinergic drugs on methacholine- and histamine-induced bronchoconstriction in monkeys.

The effect of adrenergic and cholinergic drugs on bronchial contraction of monkeys was studied using bronchoconstriction induced by aerosol challenge with methacholine and histamine. Under the anesthesia with ketamine hydrochloride, changes in the total respiratory resistance were continuously measured in monkeys to estimate the bronchial response to both histamine and methacholine. Isoprenaline decreased bronchial susceptibility to aerosol challenge with both methacholine and histamine. Isoprenaline was also potent in antagonizing the bronchoconstriction induced by methacholine and histamine. Atropine decreased bronchial susceptibility to aerosol challenge with methacholine and also partially with histamine. Atropine also antagonized the bronchoconstriction induced by methacholine, but not by histamine. Phentolamine had neither inhibitory effects on the aerosol challenge with methacholine and histamine, nor produced an antagonistic effect on bronchoconstriction induced with methacholine and histamine.

Animals↗
PubMed1983

Inhibitory effects of histamine antagonists on the skin reaction with house dust allergen, histamine and compound 48/80 in Japanese monkeys.

Using the skin of monkeys, we studied the participation of histamine receptors in the immediate skin reaction. Intradermal injection of H2 agonist produced whealing reaction to a significant degree, although this effect was not so remarkable as the effect of H1 agonist. A non-thiourea H2 antagonist showed a significant inhibitory effect on the whealing reaction to allergen, compound 48/80, and histamine. These results suggest that H2 antagonist prevented the whealing reaction by changing the vascular reaction to secreted or exogenous histamine. However, the participation of histamine receptors on dermal mast cells in the immediate skin allergic reaction is still left inconclusive.

Animals↗
PubMed1983

Effects of an antitumor agent, ascofuranone, on the macromolecular syntheses of intact cells.

Ascofuranone (AF) has antitumor protective property on experimental tumors. We examined the action of AF on lymphoma L5178Y to explore the mechanism of the antitumor activity. AF completely prevented the growth of L5178Y at 25 micrograms/ml cytostatically. The compound exhibited general inhibitory effects on the macromolecular syntheses. Among them, protein synthesis was most severely inhibited by AF and to the same extent as by cycloheximide. AF, however, did not affect protein synthesis by cell-free system even at 2 mg/ml. Although AF inhibited the incorporation of [14C]acetate into total acid precipitable products only slightly, the synthetic pattern of simple lipids from [14C]acetate was significantly changed. Especially, the incorporation of [14C]acetate into squalene was almost completely blocked at 25 micrograms/ml. The incorporation of [14C]acetate into triglyceride was inhibited and that into cholesterol was enhanced. Concerning the diglycerides, the incorporation of [14C]acetate was enhanced and that of [3H]glycerol was inhibited. The incorporation of [3H]glycerol and [3H]mevalonate into the intact cell was significantly inhibited as compared with [14C]acetate. As those effects were not observed with cycloheximide, they were suggested to be characteristic of AF. AF inhibited hypotonic hemolysis. In contrast, hemolysis by deoxycholate was stimulated. Possible mechanism of the antitumor activity of AF is discussed.

Adult↗
PubMed1983

A new alkaline elastase of an alkalophilic bacillus.

A new alkaline elastase was purified from the culture broth of an alkalophilic Bacillus sp. Ya-B. This was a serine proteinase. Molecular weight was 25,000. The optimum pH for elastin and casein was 11.75. The enzyme had very high specific activity, 12,400 units/mg protein for casein, and 2,440 units/mg protein for elastin at the optimum pH. It showed marked preference for elastin. The relative activity of elastin/casein of this enzyme was 17 and 6 times higher than those of subtilisin BPN' and subtilisin Carlsberg, respectively. This enzyme also had higher keratin and collagen hydrolyzing activity in comparison with subtilisin.

Bacillus↗
PubMed1982

Tunicamycin-resistant mutations in mouse FM3A cells.

Tunicamycin is an antibiotic that inhibits the oligosaccharide synthesis of glycoproteins. It greatly suppressed the growth of cultured mouse mammary carcinoma FM3A cells, when added to growth medium at concentrations of more than 0.1 microgram/ml. We have developed a single-step selection system for quantitatively detecting mutations resistant to the antibiotic in FM3A cells. Mutant colonies resistant to 1-1.2 micrograms tunicamycin per ml (the optimal concentration of the selecting agent) appeared at a frequency of 10(-4) to 10(-5) in an unmutagenized population, but they increased over 50-fold in the population mutagenized with 0.5 microgram N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) per ml for 2 h and selected under optimal conditions for the time of mutation expression and cell density in selective medium. Fluctuation analysis, by the method of Luria and Delbrück, revealed that tunicamycin-resistant mutations occurred at random during proliferation in normal medium at a rate of 1.2 x 10(-6) per cell per generation. So far 45 spontaneous and MNNG-induced mutant lines have been isolated and serially passaged in the absence of tunicamycin. These mutant lines all inherited their resistance for more than 60 generations. The mutants examined in detail were 12- to 26-fold more resistant than wild-type cells in terms of the D10 value, the concentration of tunicamycin reducing the plating efficiency to 10% of the control. In the hybrids between wild-type and mutant cells the tunicamycin resistance behaved in a co-dominant manner. Tunicamycin inhibited the incorporation of [3H]mannose into the acid-insoluble cell fraction; in this respect, mutant cells were over 30-fold more resistant than wild-type cells. Possible mechanisms of tunicamycin resistance are discussed.

Animals↗
PubMed1982

Effects of tunicamycin on cell adhesion and biosynthesis of glycoproteins in aggregation-competent cells of Dictyostelium discoideum.

The effects of tunicamycin (TM) on cell adhesion and on the biosynthesis of the membrane-associated glycoproteins in aggregation-competent cells of Dictyostelium discoideum were investigated. The cohesiveness due to the EDTA-stable contact site was completely inhibited in the presence of 1 microgram/ml of TM. In contrast, when cells were treated with high concentrations of TM, the EDTA-sensitive contact site in the early developmental stage remained functional. Scanning electron microscopy showed the surface of TM-treated cells to be smoother than that of untreated cells. The membrane proteins of the aggregation-competent cells and TM-treated cells were analyzed by polyacrylamide gel electrophoresis (PAGE) in the presence of sodium dodecyl sulfate (SDS). The results showed that several protein bands at 190 kd, 170 kd, 150 kd, 135 kd, 127 kd, 94 kd, 80 kd, 68 kd, 61 kd, and 52 kd which were observed in the untreated cells disappeared in the TM-treated cells, and protein bands at 105 kd and 70 kd were newly detected in the treated cells. Tunicamycin inhibited the incorporation of [3H]mannose or [14C]glucosamine into the trichloroacetic acid (TCA)-insoluble material of the aggregation-competent cells, while it did not affect [3H]leucine incorporation. These results suggest that an asparagine-linked carbohydrate moiety of membrane-associated glycoprotein(s) is involved in cell adhesion of aggregation-competent cells of D. discoideum.

Dictyostelium↗
PubMed1982

Antitumor protective property of an isoprenoid antibiotic, ascofuranone.

Ascofuranone (AF) showed an antitumor protective effect on L-1210 leukemia when AF was administered once 7 days before tumor challenge. However, effect was not elicited when host mice were treated with AF simultaneously with tumor challenge. AF pretreatment on day 7, 5 and 3 before tumor challenge protected the host from the ascites form of S-180. AF also retarded tumor growth when administered once daily for 5 consecutive days 24 hours after transplantation, but antitumor effect was not seen with combined treatments before and after the transplantation. Similar results were noted with Ehrlich ascites carcinoma. AF treatment of normal mice enlarged the solid lymphoid organs without affecting body weight gain. The splenocytes derived from AF-treated mice lowered mitogenic response to phytohemagglutinin, while the mitogenic response to concanavalin A and lipopolysaccharide was unaffected.

Animals↗