Biomedical subjects

G S Shadel

Publications and source records attributed to G S Shadel.

22 records · Page 2Linked to original sources

PubMed1990

Use of regulated cell lysis in a lethal genetic selection in Escherichia coli: identification of the autoinducer-binding region of the LuxR protein from Vibrio fischeri ATCC 7744.

A lethal genetic selection utilizing the bacteriophage lambda lysis genes (S, R, RZ) has been developed and used in conjunction with a luminescence screen to allow the isolation and characterization of six missense mutations and two nonsense mutations in the luxR gene from Vibrio fischeri ATCC 7744. A transcriptional fusion of the lysis genes in operonR downstream of a truncated luxI gene allows control of cell lysis by the addition of synthetic autoinducer to the growth medium. The six missense mutations isolated resulted in changes in the LuxR protein of Asp at position 79 to Asn (hereafter designated as D79N), V82I, V109L, L118F, S123I, and H217Y. Variant LuxR proteins with amino acid changes of D79N, V82I, V82L, and H127Y were shown to require higher concentrations of autoinducer to elicit a certain amplitude response than is required by the wild-type protein. We believe that the clustering of a total of seven randomly generated missense mutations in a 49-amino-acid region of the LuxR primary sequence defines a critical portion of the LuxR protein. The observation that proteins with lesions in this region responded to elevated levels of autoinducer suggests that the autoinducer-binding site is constructed, at least in part, from several amino acid residues within the 79-to-127 region of the LuxR protein.

Amino Acid Sequence↗

PubMed1989

The complete nucleotide sequence of the lux regulon of Vibrio fischeri and the luxABN region of Photobacterium leiognathi and the mechanism of control of bacterial bioluminescence.

We have determined the complete nucleotide sequence of a 7622 base pair fragment of DNA from Vibrio fischeri strain ATCC7744 that contains all the information required to confer plasmid-borne, regulated bioluminescence upon strains of Escherichia coli. The lux regulon from V. fischeri consists of two divergently transcribed operons, L (left) and R (right), and at least seven genes, luxR (L operon) and luxICDABE (R operon) and the intervening control region. The luxA and luxB genes encode respectively the alpha and beta subunits of luciferase. The gene order luxCDABE seen in V. fischeri is the same as for V. harveyi. We have determined the sequence of the luxAB and flanking regions from Photobacterium leiognathi and have found upstream sequences homologous with luxC from the Vibrio species, but between luxB and luxE, there is an open reading frame encoding a protein of 227 amino acids (26,229 molecular weight) that is not found in this location in the Vibrio species. The amino terminal amino acid sequence of the encoded protein is nearly identical to that determined by O'Kane and Lee (University of Georgia) for the non-fluorescent flavoprotein from a closely related Photobacterium species (Dr Dennis O'Kane, personal communication). We have therefore designated this gene luxN. There is a 20-base inverted repeat ACCTGTAGGAxTCGTACAGGT, centred between bases 927 and 928 in the region between the two operons of V. fischeri. This region appears to fulfil two functions: it is critical for the LuxR protein to exert its effect and it is a consensus binding site for the E. coli LexA protein, a negative regulatory protein involved with the SOS response. There are sequences within the luxR coding region that appear to function in a cis-acting fashion to repress transcription from both the leftward and rightward promoters in the absence of the respective transcriptional activator proteins, thereby resulting in low basal levels of transcription. It now appears clear that there are multiple levels of control on the lux system allowing for a modulation of the intensity of bioluminescence of over four orders of magnitude.

Amino Acid Sequence↗

PubMed1989

Identification of the operator of the lux regulon from the Vibrio fischeri strain ATCC7744.

Escherichia coli that carry a recombinant plasmid bearing the Vibrio fischeri lux regulon express luminescence that mimics the luminescence of V. fischeri. The lux regulon consists of two divergently transcribed operons, the rightward operon (luxICDABE genes) and the leftward operon (luxR gene). The luxR and luxI genes and the control region separating the two operons supply the primary regulatory control over the lux regulon; the regulatory mechanisms result in a dramatic increase in the rate of luciferase synthesis after induction, apparently due to a unique autoregulatory positive feedback mechanism, and in an enormous difference (greater than 10(4] in levels of luminescence in cells before and after induction. The generally accepted model of primary regulation of bioluminescence in V. fischeri involves the interaction of the product of the luxR gene and N-(3-oxohexanoyl)homoserine lactone, the autoinducer produced by the enzyme encoded by luxI, the first gene of the rightward operon, with an operator sequence within the control region to stimulate transcription of the rightward operon in a positive feedback loop. We have used deletion mapping of a transcription reporter vector to determine the approximate location of the operator. By site-directed mutagenesis of the presumed operator, we have demonstrated that the 20-base-pair inverted repeat ACCTGTAGGA/TCGTA CAGGT (where the vertical line is the center of symmetry), which bears striking similarity to the recognition sequence for the pleiotropic repressor protein LexA, is the operator of the lux regulon. We also found that deletion of sequences upstream of the palindrome leads to increased transcription from the rightward promoter (PR), indicative of a cis-acting element that represses transcription in the absence of the LuxR-autoinducer complex. Modifications of the palindrome that eliminate stimulation by LuxR-autoinducer of transcription from PR have no effect on repression by the cis-acting mechanism(s), suggesting that the palindrome is not necessary for repression of the rightward operon. Thus, it appears that the large increase in transcription upon induction of the lux regulon is the result of at least two independent mechanisms, one positive and the other negative.

Amino Acid Sequence↗

PubMedDate not supplied

Control of the lux regulon of Vibrio fischeri.

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗