Biomedical subjects

G R Sutherland

Publications and source records attributed to G R Sutherland.

At least 145 records · Page 8Linked to original sources

PubMed1998

Characterization and chromosome location of the gene GSTZ1 encoding the human Zeta class glutathione transferase and maleylacetoacetate isomerase.

The Zeta class of cytosolic glutathione-S-transferases (GSTs) has recently been identified and spans a range of species from plants to humans. The cDNA and protein of a human member of this class have been previously characterised in our laboratory. This cDNA has also been described as maleylacetoacetate isomerase (MAAI), an enzyme of the phenylalanine catabolism pathway (Fernandez-Canon and Penalva, 1998). The present study has determined the structure and chromosome location of the gene encoding human GSTZ1/MAAI. The gene spans approximately 10.9 kb and is composed of 9 exons. Three intron positions of GSTZ1 were precisely conserved compared to the carnation and Caenorhabditis elegans Zeta GST genes. Fluorescent in situ hybridization mapped the gene to a single locus on chromosome 14q24.3, which is in agreement with an independent localization between the Genethon markers D14S263 and D14S67. The coding region of the gene differed from the GSTZ1 cDNA at two nucleotide positions in exon 3, resulting in Lys-32-->Glu and Arg-42--> Gly substitutions. This gene structure information will allow analysis of the polymorphism in genomic DNA samples, and enables further investigations into genetic defects in this step of the phenylalanine catabolism pathway.

Amino Acid Sequence↗

PubMed1998

Behavioral testing does not exacerbate ischemic CA1 damage in gerbils.

BACKGROUND AND PURPOSE: Previous research studying ablative lesions has suggested that functional use may exacerbate brain injury. If true, this would have considerable ramifications not only for the mechanistic understanding of neuronal injury but also for the clinical use of physiotherapy. In this report the hypothesis that behavioral use of brain tissue exacerbates ischemic hippocampal injury was tested. METHODS: Gerbils were subjected to sham operation or 5 minutes of normothermic ischemia. To produce borderline hippocampal CA1 injury and enhance susceptibility to exacerbation, 2 of 3 ischemic groups were cooled (>48 hours) beginning at 6 hours after ischemia. Increased use of the hippocampus was produced by a battery of tests involving 3 novel small mazes, a T maze, and an open field. One hypothermic group was not tested and served as a control. RESULTS: Behavioral testing failed to worsen ischemic damage since neuronal loss in the behaviorally tested and untested hypothermic groups was 12% and 8%, respectively, while that in the untreated ischemic group was 81% at a 1-month survival. Accordingly, protected CA1 cells tolerated the neuronal activity associated with behavioral testing. Concomitant with marked CA1 neuroprotection, a significant reduction in behavioral deficits with the hypothermic treatment was observed. Importantly, behavioral testing was found to transiently elevate brain temperature. CONCLUSIONS: CA1 neuronal survival was unaffected by behavioral testing or the associated mild fever. Hypothermia delayed for 6 hours provided sustainable CA1 neuroprotection.

Animals↗

PubMed1997

Assignment of the Y4 receptor gene (PPYR1) to human chromosome 10q11.2 and mouse chromosome 14.

The human and mouse genes for the neuropeptide Y4 receptor have been isolated, sequenced, and shown to contain no introns within the coding region of the gene. Nonisotopic in situ hybridization and interspecific mouse backcross mapping have localized the genes to human chromosome 10q11.2 and mouse chromosome 14. Five nucleotide variants, which do not alter the protein sequence, have been identified within the coding region of the human receptor gene. The human Y4 subtype is most closely related to the Y1-receptor subtype (42%), suggesting that it evolved from an ancestral Y1-like receptor via an RNA-mediated transpositional event.

Animals↗

PubMed1997

A novel epithelial-expressed ETS gene, ELF3: human and murine cDNA sequences, murine genomic organization, human mapping to 1q32.2 and expression in tissues and cancer.

The ETS family of genes are implicated in cancers such as Ewings sarcoma, acute myeloid leukemia and chronic myelomonocytic leukemia. Further, they have important functions in embryonic development. Hence, identification and characterization of members of this family are important. We identify a novel ETS family member, ELF3, and report its human and murine cDNA sequences. The mouse cDNA has an alternatively spliced transcript with an extra 60 bp inserted. Hence we present the organization of the murine Elf3 gene together with its exon/intron structure. This gene consists of 9 exons and 8 introns spanning 4.8 kb. ELF3 binds and transactivates ETS sequences and interestingly also shows the ability to bind a GGAT-like purine core, a preferential ETS1/ETS2 type binding site. The expression of ELF3, unlike most other ETS family members, is absent in hematopoietic cells and hematopoietic organs in humans and mice. Intriguingly, the gene is specifically expressed in cell lines of epithelial origin and in organs such as lung, stomach, intestine, kidney that have specialized epithelial cells. We localize the human gene to 1q32.2, a region that is amplified in epithelial tumors of the breast, lung and prostate. Finally, we show that ELF3 expression is increased in a lung carcinoma and adenocarcinoma, as compared to normal tissue. ELF3 is also expressed in cell lines derived from lung cancers. These results suggest that this novel ETS gene may be involved in lung tumorigenesis.

Amino Acid Sequence↗

PubMed1997

Gene structure and subcellular localization of FMR2, a member of a new family of putative transcription activators.

FMR2 is the gene associated with FRAXE mental retardation. It is expressed as an 8.7-kb transcript in placenta and adult brain. A fetal-specific FMR2 transcript of approximately 12 kb was detected in fetal brain and at a lower level in fetal lung and kidney. FMR2 is a large gene composed of 22 exons spanning at least 500 kb on Xq28. Alternative splicing involving exons 2, 3, 5, 7, and 21 was not tissue specific as tested on mRNA from human fetal and infant brain. FMR2 is translated into a 1311-amino-acid nuclear protein with putative transcription transactivation potential. Subcellular localization studies with green fluorescent protein as a reporter show that both nuclear addresses found in the FMR2 sequence are functional and direct the FMR2 protein into the nucleus. FMR2 together with AF4 and LAF4 forms a new family of nuclear proteins with DNA-binding capacity and transcription transactivation potential. BLAST searches of the dbEST database revealed the presence of at least two other groups of nonoverlapping ESTs showing high similarity to the FMR2-related family of proteins. One of them, represented by the EST W26686, maps to chromosome 5q31. Amino acid similarity among the proteins encoded by members of the gene family is high in the NH2 terminus, low in the middle, and high again in the COOH end. Available information from members of the family shows that genomic organization is conserved. This FMR2-related gene family encodes nuclear proteins with involvement in mental retardation (FMR2), cancer (AF4), and lymphocyte differentiation (LAF4) or with unknown function (EST W26686 and/or AA025630).

Adult↗

PubMed1997

Thermodynamics of binding of the distal calcium to manganese peroxidase.

We previously demonstrated that manganese peroxidase from Phanerochaete chrysosporiumwas susceptible to thermal inactivation due to release of the distal calcium, which maintained the distal heme environment of the enzyme [Sutherland, G. R. J., Zapanta, L. S., Tien, M., & Aust, S. D. (1997) Biochemistry 36, 3654-3662]. In this investigation the binding of calcium to the distal calcium binding site of manganese peroxidase was studied by optical absorption spectroscopy and isothermal titration calorimetry. The dissociation constant for the distal calcium binding site was 11 +/- 1 microM and the Hill coefficient was 1.1 +/- 0.1. The binding of calcium was accompanied by decreases in enthalpy and entropy that were large compared to those of other calcium binding proteins. The decreases were consistent with the large conformational changes proposed to occur in manganese peroxidase as a result of the binding and release of the distal calcium. Studies involving binding of the hydrophobic fluorescent probe, 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid, dipotassium salt (bis-ANS), to manganese peroxidase indicated that the active, calcium-containing form of the enzyme had less exposed hydrophobic surface area, which would contribute to an increase in enthalpy and entropy upon calcium binding. Therefore, the negative changes in enthalpy and entropy associated with calcium binding were attributed to a large increase in the structural rigidity and compactness of the enzyme. The dissociation constant for calcium decreased and the rate of thermal inactivation decreased with decreasing pH. However, both the ability of calcium to prevent thermal inactivation of manganese peroxidase and the rate of calcium binding decreased as the pH decreased. Therefore it was proposed that, at lower pH, calcium binding to manganese peroxidase was more thermodynamically favorable, but the rate of calcium binding decreased because the flexibility of the calcium binding site, and in turn exposure of the ligands to the incoming ion, decreased.

Anilino Naphthalenesulfonates↗

PubMed1997

AMP-activated protein kinase isoenzyme family: subunit structure and chromosomal location.

The AMP-activated protein kinase (AMPK) consists of catalytic alpha and non-catalytic, beta and gamma (38 kDa) subunits and is responsible for acting as a metabolic sensor for AMP levels. There are multiple genes for each subunit and we find that rat liver AMPK-alpha2 isoform catalytic subunit is associated with beta1 and gamma1 and not with beta2 or gamma2 subunit isoforms. The beta1 and gamma1 isoforms are also subunits of the alpha1 isoform. The sequence of cloned human AMPK-beta1 is 95% identical in amino acid sequence with rat beta1. Human chromosomal localizations were determined for AMPK-alpha1 (5p11-p14), AMPK-beta1 (12q24.1-24.3) and AMPK-gamma1 (12q12-q14), respectively.

AMP-Activated Protein Kinases↗

PubMed1997

Role of calcium in maintaining the heme environment of manganese peroxidase.

We previously demonstrated that manganese peroxidase from the white-rot fungus Phanerochaete chrysosporium was very susceptible to thermal inactivation due to the loss of calcium from the enzyme [Sutherland & Aust (1996) Arch. Biochem. Biophys. 332, 128-134]. The structural changes that occur during thermal inactivation and the release of calcium from manganese peroxidase have now been characterized. Thermal inactivation caused distinct alterations in the heme environment and slight changes in the overall protein structure, both of which were reversed upon reactivation of the enzyme with calcium. The absorption spectrum of inactivated manganese peroxidase was similar to that of low-spin ferric heme proteins, indicating that a sixth ligand had bound to the distal side of the heme iron. Consistent with disruption of the distal heme environment, thermally inactivated manganese peroxidase did not react with hydrogen peroxide to form compound I. The inactive enzyme exhibited a pH-dependent absorption transition with a pKa of 5.7. Studies involving imidazole indicated that the sixth ligand may be a distal histidine. Low-temperature electron paramagnetic resonance spectroscopy confirmed that the heme iron of the inactivated form of manganese peroxidase was predominantly in a low-spin state. The near-ultraviolet/visible circular dichroism spectrum also supported the proposed formation of a highly symmetric bis(imidazole) heme complex upon thermal inactivation of the enzyme. A recombinant manganese peroxidase, in which the distal calcium binding site was altered such that calcium binding would be minimized, was also characterized. This enzyme, D47A, had the same catalytic and spectroscopic properties and calcium content as thermally inactivated manganese peroxidase. Therefore, the inactivation and structural changes that occurred during thermal incubation of manganese peroxidase could be explained by the loss of the distal calcium.

Basidiomycota↗

PubMed1997

Isolation and identification of homeobox genes from the human placenta including a novel member of the Distal-less family, DLX4.

We have carried out a DNA binding site screen of a 32-week human placental cDNA library using a consensus homeodomain binding site as a probe. This study represents the first library screen carried out to isolate homeobox genes from the human placenta. We have shown that three homeobox genes known to be expressed in the embryo, HB24, GAX and MSX2 are also expressed in the placenta. We have also identified a novel homeobox gene, DLX4, that shows 85% sequence identity with the homeodomain encoded by the Drosophila Distal-less (Dll) gene. DLX4 therefore represents a new member of the Distal-less family of homeobox genes. This is the first evidence that members of the Distal-less family of homeobox genes are expressed in the placenta. Using fluorescence in situ hybridisation (FISH), DLX4 has been assigned to human chromosome 17q21-q22. This places DLX4 in the same region of chromosome 17 as another member of the Distal-less family, DLX3 (Scherer et al., 1995), and the HOX-B homeobox gene cluster (Acampora et al., 1989: Boncinelli et al., 1991). Members of the Distal-less family (DLX1 and DLX2; DLX5 and DLX6) are found as closely linked pairs on human chromosomes (Simeone et al., 1994). We predict that DLX3 and DLX4 are closely linked and have arisen through gene duplication and divergence from a common ancestral precursor.

Amino Acid Sequence↗

PubMed1997

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Base Composition↗

PubMed1997

Analysis of reproducibility of reference lumen quantitation with intravascular ultrasound in stented coronary arteries.

Intravascular ultrasound is widely used to guide coronary stent implantation. The key quantitative criterion for successful implantation is the demonstration of adequate expansion of the stented lumen relative to that of the adjacent reference vessel segments. In this study we aimed to establish the reproducibility of intravascular ultrasound measurements of the reference segments in lesions undergoing coronary stenting. Measurements of the reference segment lumen dimensions warn made in a blinded fashion by two experienced observers, and reproducibility was assessed by calculating the mean difference and standard deviation of the paired measurements. The unselected intraobserver random variability of the mean reference lumen area measured 0.6 mm2. The interobserver random variability was 0.94 mm2. The intraobserver and interobserver variability of minimum lumen area within the stent was smaller, measuring 0.30 mm2 and 0.52 mm2, respectively. There was 91% intraobserver agreement, and 75% interobserver agreement, in identifying adequate stent expansion as defined by a stent-to-mean reference lumen area ratio of > 0.8. The potentially significant level of variability inherent in selecting and measuring the reference segments, and its impact on clinical decision-making, should be remembered when this method of assessing the acute quantitative outcome of stent implantation is applied.

Angioplasty, Balloon, Coronary↗

PubMed1997

Cloning, characterisation and chromosomal assignment of the human adenosine A3 receptor (ADORA3) gene.

The gene for the inhibitory G-protein coupled human A3 adenosine receptor (ADORA3) was isolated and sequence analysis shows that the coding region is interrupted by a single intron of size 2.4 kb. The location of this intron in the second intracellular loop is conserved with respect to the A1, A2a and A2b adenosine receptor subtype genes. The ADORA3 gene was mapped to 1p13.3 by fluorescence in situ hybridisation. Northern blot studies show that the gene is widely expressed and is most abundant in brain and some endocrine tissues. We have mapped multiple transcription start sites in two cell lines and lung tissue by primer extension and 5' RACE (rapid amplification of cDNA ends). The ADORA3 gene promoter lacks CAAT and TATA boxes but has putative binding sites for multiple transcription factors. In contrast to the A1 adenosine receptor gene we find no evidence of alternate splicing in the 5' untranslated region of the ADORA3 gene.

Base Sequence↗

PubMed1997

A study of the quantitative and qualitative impact of catheter shaft angulation in a mechanical intravascular ultrasound system.

Nonuniform rotation of mechanical intravascular ultrasound transducers may give rise to a geometric distortion of the ultrasound image known as the rotation angle artefact. This investigation studied the influence of different degrees and combinations of catheter shaft angulation on image morphology and the quantitative impact of the artefact using a circular perspex phantom and 3.5 F, 30 MHz Boston Scientific "Sonicath" catheters connected to a Hewlett Packard Sonos intravascular scanner. Major and minor diameters, cross-sectional area and circumference of the phantom lumen were measured and a "distortion index" calculated. Visually apparent geometric distortion was graded from 1 (absent) to 4 (severe). As expected, eccentric transducer location was associated much more frequently with identifiable distortion (70%) than was a concentric location (6%). Greater distortion occurred with increasing degrees of catheter shaft angulation, and was more pronounced in images from older catheters. The lumen area measurements in images in which no artefact was identified were accurate to within +/- 10% in 97% of cases, compared to only 81% of cases when an artefact was noted. The quantitative accuracy of an image in which geometric distortion is identified is thus not reliable. The direction of the quantitative error cannot be confidently predicted in any given case, although the mean lumen area tends to increase as the grade of distortion increases.

Artifacts↗

PubMed1997

Doppler myocardial imaging vs. B-mode grey-scale imaging: a comparative in vitro and in vivo study into their relative efficacy in endocardial boundary detection.

Doppler myocardial imaging (DMI) is a new ultrasound imaging modality in which colour Doppler algorithms are adapted to visualise the myocardium. It allows measurement of regional intramyocardial velocities and quantification of intramural left ventricular function. However promising the technique is, to date the accuracy of endocardial boundary detection by DMI has not been validated. As Doppler velocity estimation is based on measurement of phase shift rather than signal strength, the technique is relatively independent of chest wall attenuation. In the current study, a series of in vitro and in vivo studies was performed to compare standard B-mode grey-scale imaging (GSI) and DMI techniques in endocardial boundary detection. In vitro, the minimum and maximum volumes of a single-chamber tissue-mimicking phantom were calculated using both imaging techniques. In vivo, left ventricular end-diastolic (ED) volume and end-systolic (ES) volume indices were measured from GSI and DMI images in a group of 40 volunteers. All images were obtained in the freeze-frame mode with the Doppler display turned on and off so that simultaneous DMI and GSI information was obtained. In vitro, the limits of agreement between the minimum volume of the phantom and the minimum volume measured by GSI and DMI was 4% and 3%, respectively. For maximum volumes, limits of agreement were 3% for GSI and 2% for DMI. In vivo, the limits of agreement between the two imaging techniques in volume measurements were 6 mL (9%) for ED and 4 mL (11%) for ES. The comparison of the endocardial boundary detection by GSI vs. DMI showed DMI to be significantly superior: ED (72 +/- 16% vs. 85 +/- 8%, respectively; p < 0.05) and ES (71 +/- 13% vs. 88 +/- 7%, respectively; p < 0.05). The results of the study show that: (1) in vitro, based on two-dimensional algorithms, DMI provides as accurate volume measurements as GSI; and (2) in vivo, there is a very good agreement of left ventricular volume measurements between GSI and DMI. However, the endocardial boundary is more reliably displayed and visually easier to detect using DMI than GSI.

Adult↗

PubMed1997

Characterisation of atherosclerotic plaque by spectral analysis of intravascular ultrasound: an in vitro methodology.

Raw 30-MHz intravascular ultrasound data have been captured from postmortem coronary arteries (n = 4) to develop radio frequency analysis techniques for the characterisation of atherosclerotic plaque. Digitised data acquired from positions (n = 8) within diseased sections of artery were compared with the corresponding histology and radiology. Scan-converted images were used to locate regions of interest (ROI = 33) within areas of tissue composition: loose fibrotic tissue (LFT), dense fibrotic tissue (DFT) and calcium (CA). A range of parameters was extracted from the normalised power spectrum of each ROI within the bandwidth 17-42 MHz. Significant discrimination between LFT/DFT and between LFT/CA was provided by maximum power and spectral slope (dBMHz-1). However, the greatest discriminative power was given by the y-axis (0 Hz) intercept of the spectral slope: LFT/DFT (p = 0.001); LFT/CA (p = 0.0001); and DFT/CA (p = 0.089).

Coronary Artery Disease↗

PubMed1997

Differences in myocardial velocity gradient measured throughout the cardiac cycle in patients with hypertrophic cardiomyopathy, athletes and patients with left ventricular hypertrophy due to hypertension.

OBJECTIVES: We sought to compare the myocardial velocity gradient (MVG) measured across the left ventricular (LV) posterior wall during the cardiac cycle between patients with hypertrophic cardiomyopathy (HCM), athletes and patients with LV hypertrophy due to systemic hypertension and to determine whether it might be used to discriminate these groups. BACKGROUND: The MVG is a new ultrasound variable, based on the color Doppler technique, that quantifies the spatial distribution of transmyocardial velocities. METHODS: A cohort of 158 subjects was subdivided by age into two groups: Group I (mean [+/-SD] 30 +/- 7 years) and Group II (58 +/- 8 years). Within each group there were three categories of subjects: Group Ia consisted of patients with HCM (n = 25), Group Ib consisted of athletes (n = 21), and Group Ic consisted of normal subjects; Group IIa consisted of patients with HCM (n = 19), Group IIb consisted of hypertensive patients (n = 27), and Group IIc consisted of normal subjects (n = 33). RESULTS: The MVG (mean [+/-SD] s-1) measured in systole was lower (p < 0.01) in patients with HCM (Group Ia 3.2 +/- 1.1; Group IIa 2.9 +/- 1.2) compared with athletes (Group Ib 4.6 +/- 1.1), hypertensive patients (Group IIb 4.2 +/- 1.8) and normal subjects (Group Ic 4.4 +/- 0.8; Group IIc 4.8 +/- 0.8). In early diastole, the MVG was lower (p < 0.05) in patients with HCM (Group Ia 3.7 +/- 1.5; Group IIa 2.6 +/- 0.9) than in athletes (Group Ib 9.9 +/- 1.9) and normal subjects (Group Ic 9.2 +/- 2.0; Group IIc 3.6 +/- 1.5), but not hypertensive patients (Group IIb 3.3 +/- 1.3). In late diastole, the MVG in patients with HCM (Group Ia 1.3 +/- 0.8; Group IIa 1.4 +/- 0.8) was lower (p < 0.01) than that in hypertensive patients (Group IIb 4.3 +/- 1.7) and normal subjects (Group IIc 3.8 +/- 0.9). An MVG < or = 7 s-1, as a single diagnostic approach, differentiated accurately (0.96 positive and 0.94 negative predictive value) between patients with HCM and athletes when the measurements were taken during early diastole. CONCLUSIONS: In both age groups, the MVG was lower in both systole and diastole in patients with HCM than in athletes, hypertensive patients or normal subjects. The MVG measured in early diastole in a group of subjects 18 to 45 years old would appear to be an accurate variable used to discriminate between HCM and hypertrophy in athletes.

Adult↗

PubMed1997

Dynamic mutation: possible mechanisms and significance in human disease.

Increases in repeat-DNA copy number are the molecular basis of a growing list of human genetic diseases, including fragile X syndrome, myotonic dystrophy, Huntington disease and a form of epilepsy. Repeat-DNA sequences undergo a unique process of dynamic mutation, the common properties of which probably reflect common molecular events. This form of mutation is no longer restricted to trinucleotide repeats, because repeats of different length have been found to undergo expansion.

Genetic Diseases, Inborn↗

PubMed1997

LAIR-1, a novel inhibitory receptor expressed on human mononuclear leukocytes.

In the present study, we describe a novel inhibitory receptor, leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1), that is constitutively expressed on the majority of human peripheral blood mononuclear leukocytes. LAIR-1 is a 32 kDa transmembrane glycoprotein with a single immunoglobulin-like domain and a cytoplasmic tail containing two immune receptor tyrosine-based inhibitory motifs. LAIR-1 recruits SHP-1 and SHP-2 phosphatases upon activation, and cross-linking of the LAIR-1 antigen on natural killer (NK) cells results in strong inhibition of NK cell-mediated cytotoxicity. Although it is structurally related to human killer cell inhibitory receptors, LAIR-1 does not appear to recognize human leukocyte antigen (HLA) class I molecules and thus represents a novel HLA class I-independent mechanism of NK cell regulation.

Amino Acid Sequence↗