Search PubMed⌕ Search

Biomedical subjects

G E Fox

Publications and source records attributed to G E Fox.

At least 73 records · Page 4Linked to original sources
PubMed1984

16S rRNA oligonucleotide catalog data base.

We have developed a package of programs to create, maintain and manipulate a data base of 16S rRNA oligonucleotide catalog data. For the first time all the published catalog data is brought together in one place in a readily usable form. The package allows generation of dendrograms, facilitates searches for related oligonucleotides between catalogs, and allows construction of global and local dictionaries. Interactive capabilities allow for searches of the dictionary as well as an associated file of likely oligonucleotide families.

Base Sequence↗
PubMed1984

The phylogeny of purple bacteria: the alpha subdivision.

The technique of oligonucleotide cataloging shows the purple photosynthetic eubacteria to comprise three major subdivisions, temporarily called alpha, beta, and gamma--previously designated groups I-III by Gibson et al. (1979). Each subdivision contains a number of non-photosynthetic genera in addition to the photosynthetic ones. The alpha subdivision, the subject of the present report, contains most but not all of the species that fall into the classically defined genera Rhodospirillum, Rhodopseudomonas and Rhodomicrobium. Intermingled with these are a variety of non-photosynthetic species from genera such as Agrobacterium, Rhizobium, Azospirillum, Nitrobacter, Erythrobacter, Phenylobacterium, Aquaspirillum, and Paracoccus. The phylogenetic substructure of the alpha subdivision is presented and the evolutionary significance of the admixture of biochemical phenotypes is discussed.

Base Sequence↗
PubMed1984

The ribonucleotide sequence of 5s rRNA from two strains of deep-sea barophilic bacteria.

Deep-sea bacteria were isolated from the digestive tract of animals inhabiting depths of 5900 m in the Puerto Rico Trench and 4300 m near the Walvis Ridge. Growth of two bacterial strains was measured in marine broth and in solid media under a range of pressures and temperatures. Both strains were barophilic at 2 degrees C (+/- 1 degrees C) with an optimal growth rate of 0.22 h-1 at a pressure 30% lower than that encountered in situ. At 1 atm they grew at temperatures ranging from 1.2 to 18.2 degrees C (+/- 0.3 degrees C), while in situ pressures increased the upper temperature limit to 23.3 degrees C. Both strains were identified as members of the genus Vibrio, based on standard taxonomic tests and mol% G + C values (47.0 and 47.1). Ribonucleotide sequences determined for 5S ribosomal RNA from each strain confirmed relationship to the Vibrio-Photobacterium group, as represented by V. harveyi and P. phosphoreum, but the barophiles were clearly distinct from these species. Secondary structure conformed to the established model for eubacterial 5S rRNA.

Animals↗
PubMed1981

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.

Base Sequence↗
PubMed1981

Molecular relationships between closely related strains and species of nematodes.

Electrophoretic comparisons have been made for 24 enzymes in the Bergerac and Bristol strains of Caenorhabditis elegans and the related species, Caenorhabditis briggsae. No variation was detected between the two strains of C. elegans. In contrast, the two species, C. elegans and C. briggsae exhibited electrophoretic differences in 22 of 24 enzymes. A consensus 5S rRNA sequence was determined for C. elegans and found to be identical to that from C. briggsae. By analogy with other species with relatively well established fossil records it can be inferred that the time of divergence between the two nematode species is probably in the tens of millions of years. The limited anatomical evolution during a time period in which proteins undergo extensive changes supports the hypothesis that anatomical evolution is not dependent on overall protein changes.

Base Sequence↗
PubMed1981

Secondary structure of eukaryotic cytoplasmic 5S ribosomal RNA.

A five-helix secondary structural model is proposed for eukaryotic cytoplasmic 5S rRNA. All available sequence data are consistent with this model including those from Chlorella 5S rRNA whose sequence is revised by data included here. Various architectural features of eukaryotic 5S rRNA are summarized in terms of this secondary structural model. It is observed that previous failures to identify universal models for 5S rRNA secondary structure stem from significant differences in architecture between eukaryotic cytoplasmic and eubacterial 5S rRNAs. The usual four-helix model for eubacterial 5S rRNA secondary structure nevertheless does share several structural features with the five-helix model presented here for cytoplasmic 5S rRNA. It is thus likely that these two classes of 5S rRNA are the result of evolutionary divergence rather than convergence.

Animals↗
PubMed1981

A phylogenetic analysis of staphylococci, Peptococcus saccharolyticus and Micrococcus mucilaginosus.

The intra- and intergeneric relationships of the genus Staphylococcus, and the phylogenetic position of Peptococcus saccharolyticus and Micrococcus (Staphylococcus salivarius), were investigated by comparative oligonucleotide cataloguing of 16S rRNA. All the staphylococci investigated form a phylogenetically coherent group at the genus level that, in addition, contains the anaerobic species Peptococcus saccharolyticus. The genus Staphylococcus belongs to the broad Bacillus-Lactobacillus-Streptococcus cluster that is defined by Gram-positive bacteria with a low DNA G+C content. Micrococcus mucilaginosus is not a genuine member of the genus Micrococcus. The binary matching coefficients between the 16S rRNA of Micrococcus mucilaginosus and those representatives of the Arthrobacter/Micrococcus group and related genera indicate that Micrococcus mucilaginosus should be regarded as a member of a new genus.

Base Sequence↗
PubMed1980

Do genealogical patterns in purple photosynthetic bacteria reflect interspecific gene transfer?

It is generally thought that interspecific (lateral) transfer of genes is so extensive among bacteria that it is difficult, and perhaps impossible, to determine their phylogenetic relationships. Ambler and coworkers reflect this in their suggestion that the relationships seen among cytochrome c sequences of the Rhodospirillaceae are merely the result of a haphazard lateral transfer of the particular gene, and give no indication of the true bacterial phylogenies. However, if comparative analysis of several unrelated macromolecules yields essentially the same phylogenetic tree, then that pattern is extremely unlikely to reflect the lateral transfer of genes. We have also determined 16S ribosomal RNA catalogues for many of the Rhodospirillaceae in investigated by Ambler et al. and here we use these two sets of data to compare molecular phylogenies for these bacteria.

Biological Evolution↗
PubMed1979

Cyanobacterial evolution: results of 16S ribosomal ribonucleic acid sequence analyses.

We report here the sequences of oligonucleotides released by T1-ribonuclease digestion of the 16S ribosomal RNA's (rRNA's) of unicellular cyanobacteria Agmenellum quadruplicatum (strain BG-1) and Synechococcus 7502. We compare them with sequences previously obtained for the 16S RNA's of six other cyanobacteria and two chloroplasts, and conclude that: (i) Synechocystis-like unicells form a discrete cluster which also (and surprisingly) includes Agmenelium quadruplicatum, usually considered to be a Synechococcus; (ii) filamentous cyanobacteria of the genera Nostoc and Fischerella arose from within the Synechocystis group; (iii) phylogenetic diversity (and hence presumably evolutionary antiquity) within the Synechococcus group is very great; and (iv) red algal chloroplasts are of definite cyanobacterial origin, while Euglena chloroplasts are of separate and quite possibly noncyanobacterial origin. We also present the results of a computer-aided search among the 10 oligonucleotide 'catalogues' for families of related but nonidentical sequences. Examination of these families reinforces the above conclusions.

Base Sequence↗
PubMed1978

Archaebacteria.

Experimental work published elsewhere has shown that the Archaebacteria encompass several distinct subgroups including methanogens, extreme halophiles, and various thermoacidophiles. The common characteristics of Archaebacteria known to date are these: (1) the presence of characteristic tRNAs and ribosomal RNAs; (2) the absence of peptidoglycan cell walls, with in many cases, replacement by a largely proteinaceous coat; (3) the occurrence of ether linked lipids built from phytanyl chains and (4) in all cases known so far, their occurrence only in unusual habitats. These organisms contain a number of 'eucaryotic features' in addition to their many bacterial attributes. This is interpreted as a strong indication that the Archaebacteria, while not actually eucaryotic, do indeed represents a third separate, line of descent as originally proposed.

Bacteria↗
PubMed1977

The concept of cellular evolution.

A central evolutionary question is whether the eucaryotic cytoplasm represents a line of descent that is separate from the typical bacterial line. It is argued on the basis of differences between their respective translation mechanisms that the two lines do represent separate phylogenetic trees in the sense that each line of descent independently evolved to a level of organization that could be called procaryotic. The two lines of descent, nevertheless shared a common ancestor, that was far simpler than the procaryote. This primitive entity is called a progenote, to recognize the possibility that it had not yet completed evolving the link between genotype and phenotype. This concept changes considerably the view one takes toward cellular evolution.

Anaerobiosis↗
PubMed1977

An ancient divergence among the bacteria.

The 16S ribosomal RNAs from two species of methanogenic bacteria, the mesophile Methanobacterium ruminantium and the thermophile Methanobacterium thermoautotrophicum, have been characterized in terms of the oligonucleotides produced by digestion with T1 ribonuclease. These two organisms are found to be sufficiently related that they can be considered members of the same genus or family. However, they bear only slight resemblance to "typical" Procaryotic genera; such as Escherichia, Bacillus and Anacystis. The divergence of the methanogenic bacteria from other bacteria may be the most ancient phylogenetic event yet detected--antedating considerably the divergence of the blue green algal line for example, from the main bacterial line.

Bacillus↗
PubMed1977

Classification of methanogenic bacteria by 16S ribosomal RNA characterization.

The 16S ribosomal RNAs from 10 species of methanogenic bacteria have been characterized in terms of the oligonucleotides produced by T(1) RNase digestion. Comparative analysis of these data reveals the methanogens to constitute a distinct phylogenetic group containing two major divisions. These organisms appear to be only distantly related to typical bacteria.

Journal Article↗
PubMed1977

Phylogenetic structure of the prokaryotic domain: the primary kingdoms.

A phylogenetic analysis based upon ribosomal RNA sequence characterization reveals that living systems represent one of three aboriginal lines of descent: (i) the eubacteria, comprising all typical bacteria; (ii) the archaebacteria, containing methanogenic bacteria; and (iii) the urkaryotes, now represented in the cytoplasmic component of eukaryotic cells.

Bacteria↗