Search PubMed⌕ Search

Biomedical subjects

G C Mills

Publications and source records attributed to G C Mills.

At least 19 recordsLinked to original sources
PubMed1991

Cytochrome c: gene structure, homology and ancestral relationships.

In this paper, the author notes the recommended definition of the word "homology" (i.e., indicating an ancestral relationship) and the recommended stipulation that "evidence for homology should be explicitly laid out". The postulated homology for somatic and testes-specific isozymes of cytochrome c is then examined, using recent data obtained from the study of cytochrome c genes. Consideration is also given to some newer findings of molecular biology and possibilities are considered for various types of change in the genome of an organism. Possible roles of introns, pseudogenes and multigene families are considered. The relationship of testes-specific cytochrome c to somatic cytochrome c is carefully considered from data obtained in experimental studies of genes of these two isozymes. If one assumes that these isozymes arose as a consequence of a gene duplication, data from rat and mouse genes indicate that the testes-specific isozyme has incorporated more amino acid changes than the somatic isozyme since the time of their divergence. However, when the 15 amino acid differences (testes-specific vs. somatic isozyme) are considered, there is virtually no similarity in these 15 positions of the testes-specific isozyme with any of the hypothetical ancestral sequences of the somatic isozyme. Nucleotide differences in cytochrome c genes have been evaluated by comparing genes for the two rodent cytochrome c isozymes to cytochrome c genes of fruit flies, chickens and humans. Comparisons of nucleotide substitution rates in genes for the two cytochrome c isozymes in rodents confirm the conclusions from amino acid sequence comparisons; namely, that more rapid nucleotide changes have occurred in the testes-specific cytochrome c gene, than in the somatic cytochrome c gene. Possible explanations for these findings are considered.

Amino Acid Sequence↗
PubMed1989

Isolation and identification of S-adenosylmethionine from human urine.

Procedures are described for the isolation and identification of adenosylmethionine from human urine. Previously described preliminary separative procedures using anion and cation exchange columns and an XAD-4 resin column have been extended to permit the separation of adenosylmethionine. The adenosylmethionine has been identified by conversion to methylthioadenosine followed by rechromatography of the latter compound with three different types of columns and elution systems. Mean adenosylmethionine values for urine were as follows: adults, 0.26; children, 0.36 nmole/mumole creatinine. Recovery of adenosylmethionine added to urine and determined by this separative procedure was 52%.

Adult↗
PubMed1989

1-Methyladenine in urine of an adenosine deaminase-deficient adult without immunodeficiency.

Procedures are described for the isolation and identification of 1-methyladenine from the urine of an adult female with adenosine deaminase deficiency but no immunodeficiency. Evidence is provided indicating that much of the usual urinary excretion product, 1-methyladenosine, is converted to 1-methyladenine in this subject prior to excretion. Since the nucleoside phosphorylases present in normal individuals do not act on 1-methyladenosine, this suggests that a phosphorylase with unusual properties is present in this adenosine deaminase-deficient subject. A possible role for this phosphorylase in removal of deoxyadenosine in this subject is discussed.

Adenine↗
PubMed1988

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA).

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.

Animals↗
PubMed1988

Substrate inhibition of adenosine phosphorylation in adenosine deaminase deficiency and adenosine-mediated inhibition of PP-ribose-P dependent nucleotide synthesis in hypoxanthine phosphoribosyltransferase deficient erythrocytes.

The metabolism of adenosine and its effects on phosphoribosylpyrophosphate, PP-ribose-P, dependent nucleotide synthesis were studied using erythrocytes from patients with adenosine deaminase and hypoxanthine phosphoribosyltransferase deficiency as models. The phosphorylation of adenosine was progressively inhibited by concentrations of adenosine greater than 1 mumol L-1 for control and ADA deficient erythrocytes. There was essentially no initial rate of phosphorylation at 30 mumol L-1 adenosine. Adenosine, 1 mumol L-1, also caused a 60% reduction in PP-ribose-P concentration in ADA deficient erythrocytes. For HPRT deficient erythrocytes in which ADA activity was blocked by coformycin, 10 mumol L-1 inosine stimulated PP-ribose-P dependent nucleotide synthesis from adenine, whereas, 10 mumol L-1 adenosine inhibited nucleotide synthesis. These observations suggest that adenosine phosphorylation and PP-ribose-P dependent nucleotide synthesis are inhibited under conditions in which adenosine accumulates, such as in hereditary or pharmacologically induced ADA deficiency.

Adenosine↗
PubMed1985

Urinary excretion of methylthioadenosine in immunodeficient children.

A procedure is described for the separation and determination of methylthioadenosine in human urine. The procedure has been applied to urine from normal children, children with severe combined immunodeficiency and to children with other immunodeficiencies. Methylthioadenosine excretion in normal children was 0.16 +/- 0.03 nmol/mumol creatinine. Elevated urinary excretion was noted in six of seven children with severe combined immunodeficiency (0.41-5.2 nmol/mumol creatinine). A low excretion level (0.046 nmol/mumol creatinine) was noted in a child with severe combined immunodeficiency who was germ-free.

Adenosine↗
PubMed1985

Urinary excretion of modified purines and nucleosides in immunodeficient children.

Studies have been carried out using an XAD-4 resin and ion-exchange chromatography for determination of urinary purines and nucleosides in seven children with severe combined immunodeficiency and in six normal children. These studies have included analyses for five methylated purines or nucleosides produced by catabolism of nucleic acids. The following compounds have been quantitatively determined: 1-methyladenosine, 1-methylinosine, 1-methylguanosine, 1-methylguanine, 3-methylcytidine, adenosine, methylthioadenosine sulfoxide, cytidine, and deoxycytidine. 1-Methyladenosine and 1-methylinosine were most consistently elevated in the urine of immunodeficient children. Methylthioadenosine sulfoxide was very markedly increased in urine of two of the immunodeficient children while more moderate increases were noted with a number of other nucleosides. The germ-free child with severe combined immunodeficiency showed consistently lower excretion levels of these compounds when compared to normal children.

Child↗
PubMed1985

Glucose-6-phosphate dehydrogenase Beaumont: a new variant with severe enzyme deficiency and chronic nonspherocytic hemolytic anemia.

Studies were carried out on erythrocytes and fibroblasts from a 3-year-old white male with severe glucose-6-phosphate dehydrogenase (G6PD) deficiency and chronic non-spherocytic hemolytic anemia. Red blood cell G6PD activity was less than 0.02% of normal values. Since the child's fibroblasts had 2-4% of normal enzymic activity, they were utilized as a source of enzyme for kinetic studies. The G6PD demonstrated marked heat lability, a normal Km value for glucose-6-phosphate (56 mumol/l), a nearly normal pH-activity curve, and increased utilization of 2-deoxyglucose-6-phosphate (76% of the rate with glucose-6-phosphate). These studies clearly indicate that this is a new molecular variant (G6PD Beaumont).

Adult↗
PubMed1983

Severe combined immunodeficiency in a child with a healthy adenosine deaminase deficient mother.

We investigated adenosine deaminase (ADA) deficient severe-combined immunodeficiency (SCID) in an 8-month-old child with ADA deficient mother. The ADA deficiency in the child was unusual in that the thymic histology was normal. In addition, the thymocytes formed E-rosettes with sheep erythrocytes and were stimulated by T-cell mitogens. ADA activity could not be detected in the child's thymocytes. Studies on the family indicated that the father had about one-half of the normal erythrocyte ADA activity. All the family members with detectable ADA activity appeared to have, according to starch gel electrophoresis of erythrocyte lysates, the common ADA-1 phenotype; however, rigorous identification of phenotype was not possible in this study. The mother had less than 1% of normal ADA activity in both erythrocyte and lymphocyte extracts, but her whole peripheral blood lymphocytes demonstrated about 6% of normal activity. Normal concentrations of ATP and small amounts of dATP were found in the mother's erythrocytes. Deoxyadenosine excretion in her urine was elevated and approximately 5-10% of that excreted by individuals with ADA deficient SCID. These studies suggest that low amounts of ADA activity in erythrocytes and blood lymphocytes of certain individuals may be compatible with good immune function and longevity.

Adenosine Deaminase↗
PubMed1979

Cytosine and orotic acid in urine of immunodeficient children.

We describe procedures for determining cytosine and orotic acid in urine. We determine cytosine by cation-exchange analysis with either HCl or pH 5.2 buffer as eluent. Orotic acid is first separated by an anion-exchange separative procedure; after lyophilization, the product is subjected to "high-pressure" liquid chromatography for further separation and detection. We analyzed urine from normal subjects and from immunodeficient children. Three children with severe combined immunodeficiency had increased levels of cytosine in urine (23-160 mmol/mol creatinine); one child with severe combined immunodeficiency and two children with other immunodeficiencies had normal urinary levels (less than 2 mmol/mol creatinine). Orotic acid excretion in urine was normal (1-5 mmol/mol creatinine) in all of th immunodeficient children. We discuss the possible significance of the increased cytosine excretion in the three children with severe combined immunodeficiency.

Child↗