Flipping the epigenetic switch.
Explore the source record for details and available documents.
Animals↗
Biomedical subjects
Frederick E Domann
Publications and source records attributed to Frederick E Domann.
Characterization of p53 gene mutations in a Brazilian population with oral squamous cell carcinomas.
Mutations in the p53 tumor suppressor gene are present in approximately 50% of all human cancers. We sought to determine the frequency and type of p53 mutations in squamous cell carcinomas (SCC) of the oral cavity in a Brazilian population. To identify p53 mutations we used PCR-SSCP in tumor tissue microdissected from paraffin- embedded and from fresh-frozen sections followed by direct sequencing of SSCP bands with altered electrophoretic mobility. We identified p53 mutations in 40% of the human SCC analyzed. The mutations were of a broad spectrum, with a preponderance of G --> A and A --> G transitions with an apparent hotspot at the CpG dinucleotide at codon 290. Patient samples were stratified according to tobacco and alcohol consumption as well as by anatomic location of the tumor, and although trends did emerge, no statistically significant associations were obtained between the occurance of TP53 mutations and these lifestyle habits. We conclude that p53 mutations are common among oral cavity cancers in this population, and stress the significance of this study since it is the first analysis of p53 mutation in oral cancer in a southern Brazilian population.
Adult↗
Multimodality noninvasive imaging of gene transfer using the human sodium iodide symporter.
UNLABELLED: In this study we investigated the feasibility of using radionuclide accumulation mediated by the human sodium iodide symporter (hNIS) gene in conjunction with various imaging modalities as a reporter system to noninvasively monitor the expression of transgenes delivered for gene therapy. METHODS: NIS-expressing adenovirus (Ad-hNIS) was delivered in vitro to MB-435 breast carcinoma cells. NIS-mediated accumulation of (125)I(-), (99m)TcO(4)(-), and (76)Br(-) by the cells was visualized using autoradiography, gamma-camera scintigraphy, and PET imaging, respectively. RESULTS: For all imaging modalities, signal intensity generated by the cells correlated linearly both with the amount of Ad-hNIS and with the activity of radionuclide added to the cells. CONCLUSION: hNIS-mediated cellular accumulation of radionuclide was clearly visualized by all 3 imaging modalities tested. This preliminary study demonstrates the feasibility of using hNIS for monitoring the location and magnitude of expression of genes delivered during gene therapy.
Breast Neoplasms↗
L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides.
Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.
Base Sequence↗
A nucleotide insertion in the transcriptional regulatory region of FADS2 gives rise to human fatty acid delta-6-desaturase deficiency.
Fatty acid delta-6-desaturase (FADS2) is the rate-limiting enzyme in mammalian synthesis of long-chain polyunsaturated fatty acids. We investigated the molecular mechanism of FADS2 deficiency in skin fibroblasts from a patient deficient in this enzyme. Expression analyses demonstrated an 80% to 90% decrease in the steady-state level of FADS2 mRNA in patient-derived cells compared with normal controls that was consistent with previous metabolic biochemical studies. In vitro transcription assays indicated an 80% decrease in the rate of transcriptional initiation in patient-derived cells, thus implicating transcriptional regulation as the mechanism for the decreased transcript levels. Sequence analysis of the 5' end of the gene revealed the insertion of a thymidine between positions -941 and -942 upstream of the translation start site in patient-derived cells compared with normal cells and published sequences. Promoter-reporter assays demonstrated a 6-fold decrease in promoter activity in the polymorphic variant FADS2 regulatory region compared with the normal gene, confirming the functional relevance of the insertion mutation to the decreased expression of the gene in the patient-derived cells. These findings indicate that fatty acid delta-6-desaturase deficiency and decreased FADS2 transcription are caused by a nucleotide insertion in the transcriptional regulatory region of the human FADS2 gene.
3T3 Cells↗
Dicumarol inhibition of NADPH:quinone oxidoreductase induces growth inhibition of pancreatic cancer via a superoxide-mediated mechanism.
NADPH:quinone oxidoreductase (NQO(1)), a homodimeric, ubiquitous, flavoprotein, catalyzes the two-electron reduction of quinones to hydroquinones. This reaction prevents the one-electron reduction of quinones by cytochrome P450 reductase and other flavoproteins that would result in oxidative cycling with generation of superoxide (O(2)(.-)). NQO(1) gene regulation may be up-regulated in some tumors to accommodate the needs of rapidly metabolizing cells to regenerate NAD(+). We hypothesized that pancreatic cancer cells would exhibit high levels of this enzyme, and inhibiting it would suppress the malignant phenotype. Reverse transcription-PCR, Western blots, and activity assays demonstrated that NQO(1) was up-regulated in the pancreatic cancer cell lines tested but present in very low amounts in the normal human pancreas. To determine whether inhibition of NQO(1) would alter the malignant phenotype, MIA PaCa-2 pancreatic cancer cells were treated with a selective inhibitor of NQO(1), dicumarol. Dicumarol increased intracellular production of O(2)(.-), as measured by hydroethidine staining, and inhibited cell growth. Both of these effects were blunted with infection of an adenoviral vector containing the cDNA for manganese superoxide dismutase. Dicumarol also inhibited cell growth, plating efficiency, and growth in soft agar. We conclude that inhibition of NQO(1) increases intracellular O(2)(.-) production and inhibits the in vitro malignant phenotype of pancreatic cancer. These mechanisms suggest that altering the intracellular redox environment of pancreatic cancer cells may inhibit growth and delineate a potential strategy directed against pancreatic cancer.
Adenocarcinoma↗
Mutant p53 and aberrant cytosine methylation cooperate to silence gene expression.
p53 is an important transcriptional regulator that is frequently mutated in cancer. Gene-profiling experiments of breast cancer cells infected with wt p53 revealed both MASPIN and desmocollin 3 (DSC3) to be p53-target genes, even though both genes are silenced in association with aberrant cytosine methylation of their promoters. Despite the transcriptional repression of these genes by aberrant DNA methylation, restoration of p53 resulted in the partial reactivation of both genes. This reactivation is a result of wt p53 binding to its consensus DNA-binding sites within the MASPIN and DSC3 promoters, stimulating histone acetylation, and enhancing chromatin accessibility of their promoters. Interestingly, wt p53 alone did not affect the methylation status of either promoter, suggesting that p53 itself can partially overcome the repressive barrier of DNA methylation. Pharmacologic inhibition of DNA methylation with 5-aza-2'-deoxycytidine in combination with restoration of wt p53 status resulted in a synergistic reactivation of these genes to near-normal levels. These results suggest that cancer treatments that target both genetic and epigenetic facets of gene regulation may be a useful strategy towards the therapeutic transcriptional reprogramming of cancer cells.
Azacitidine↗
Redox factor-1 contributes to the regulation of progression from G0/G1 to S by PDGF in vascular smooth muscle cells.
Redox factor-1 (Ref-1/APE), a multifunctional DNA base excision repair and redox regulation enzyme, plays an important role in oxidative signaling, transcription factor regulation, and cell cycle control. We hypothesized that Ref-1 plays a regulatory role in smooth muscle cell (SMC) proliferation induced by PDGF. Ref-1 antisense oligodeoxynucleotides (AODN), which diminished the level of Ref-1 protein in SMCs by approximately 50%, inhibited PDGF-BB (composed of the homodimer of B-polypeptide chain)-induced [3H]thymidine incorporation compared with control oligodeoxynucleotides. Ref-1 AODN inhibited PDGF-BB-induced S phase entry by approximately 63%, which was overcome by overexpression of Ref-1 by adenoviral-mediated gene transfer. Overexpression of Ref-1 alone without PDGF enhanced SMC entry into the S phase. Furthermore, decreasing Ref-1 protein by treatment of SMCs with Ref-1 AODN, or by immunodepletion of Ref-1 from nuclear extracts, inhibited PDGF-BB-induced activator protein-1 (AP-1) DNA binding activity. Chemical reduction restored the AP-1 DNA binding in Ref-1-depleted nuclear extracts. These results suggest that Ref-1 contributes to the regulation of PDGF-BB-stimulated cell cycle progression from G0/G1 to S in SMCs, with one of the possible steps being redox-regulation of AP-1 by Ref-1 protein.
Angiogenesis Inducing Agents↗
The role of manganese superoxide dismutase in the growth of pancreatic adenocarcinoma.
Chronic pancreatitis, K-ras oncogene mutations, and the subsequent generation of reactive oxygen species (ROS) appear to be linked to pancreatic cancer. ROS have also been suggested to be mitogenic and capable of stimulating cell proliferation. Cells contain antioxidant enzymes to regulate steady state levels of ROS produced by products of metabolism. The aims of our study were to determine antioxidant enzyme activity in pancreatic cancer cells and correlate enzyme activity with tumor growth, as well as determine whether tumor cell growth could be altered with antioxidant gene transfection. Western blots, enzyme activity, and enzyme activity gels were performed for manganese superoxide dismutase (MnSOD), copper/zinc, catalase, and glutathione peroxidase in normal human pancreas and in the human pancreatic cancer cell lines BxPC-3, Capan-1, MIA PaCa-2, and AsPC-1. Cell population doubling times were determined and correlated with antioxidant enzyme activity. MnSOD was overexpressed in MIA PaCa-2 using an adenoviral vector, and the effect on cell growth was determined. The cell pancreatic cancer lines BxPC-3, MIA PaCa-2, and AsPC-1 had decreased levels of MnSOD immunoreactive protein as well as activity and decreases in MnSOD levels correlated well with increased rates of tumor cell proliferation as determined by cell doubling time. No correlation could be found between cell growth and levels of copper/zinc superoxide dismutase, catalase, or glutathione peroxidase. Enforced expression of MnSOD by adenovirus transfection in the rapid growing cell line MIA PaCa-2 increased MnSOD immunoreactivity and MnSOD activity and decreased growth rate. Overexpression of MnSOD may be effective in growth suppression of pancreatic cancer.
Adenocarcinoma↗
MnSOD up-regulates maspin tumor suppressor gene expression in human breast and prostate cancer cells.
Manganese superoxide dismutase (MnSOD) is an antioxidant enzyme with tumor suppressor activity; however, the molecular mechanisms of MnSOD antitumor effects remain unclear. We hypothesized that MnSOD activity in cancer cells might cause downstream changes in the expression of other tumor suppressor genes. To determine whether maspin, a tumor suppressor gene that inhibits breast cancer cell invasion and metastasis, might be a target of MnSOD, we forced MnSOD expression in several human breast and prostate cancer cell lines by adenovirus-mediated gene transfer and measured maspin mRNA expression. Forced expression of MnSOD caused maspin mRNA to accumulate in a dose-dependent manner in both human breast and prostate cancer cells. Normal p53 was not necessary to mediate the effect of MnSOD because MnSOD up-regulated maspin in cells that harbor wild-type p53 and in cells that harbor mutant p53. Moreover, the effects of MnSOD on maspin were not due to demethylation of the maspin promoter. Analyses of maspin promoter activity, transcriptional run-on, and mRNA stability showed that maspin mRNA stability was the major mechanism for maspin up-regulation by MnSOD. Our findings identify a mechanism underlying MnSOD antitumor effects and provide evidence to support MnSOD as a genetic therapy in the treatment of human breast and prostate cancers.
Adenoviridae↗
Editorial: maspin as a molecular target for cancer therapy.
Explore the source record for details and available documents.
Breast Neoplasms↗
Role for DNA methylation in the control of cell type specific maspin expression.
The nucleotide 5-methylcytosine is involved in processes crucial in mammalian development, such as X-chromosome inactivation and gene imprinting. In addition, cytosine methylation has long been speculated to be involved in the establishment and maintenance of cell type specific expression of developmentally regulated genes; however, it has been difficult to identify clear examples of such genes, particularly in humans. Here we provide evidence that cytosine methylation of the maspin gene (SERPINB5) promoter controls, in part, normal cell type specific SERPINB5 expression. In normal cells expressing SERPINB5, the SERPINB5 promoter is unmethylated and the promoter region has acetylated histones and an accessible chromatin structure. By contrast, normal cells that do not express SERPINB5 have a completely methylated SERPINB5 promoter with hypoacetylated histones, an inaccessible chromatin structure and a transcriptional repression that is relieved by inhibition of DNA methylation. These findings indicate that cytosine methylation is important in the establishment and maintenance of cell type restricted gene expression.
Cell Line↗
Overexpression of copper zinc superoxide dismutase suppresses human glioma cell growth.
Copper zinc superoxide dismutase (CuZnSOD) is an essential primary antioxidant enzyme that converts superoxide radical to hydrogen peroxide and molecular oxygen in the cytoplasm. Cytosolic glutathione peroxidase (GPx) converts hydrogen peroxide into water. The overall goal of the present study was to explore the possible role of the antioxidant enzyme CuZnSOD in expression of the malignant phenotype. We hypothesized that overexpression of CuZnSOD would lead to the suppression of at least part of the human malignant phenotype. To test this hypothesis, human CuZnSOD cDNA was transfected into U118-9 human malignant glioma cells. CuZnSOD activity levels increased 1.5-, 2.0-, 2.6-, and 3.5-fold, respectively, in four table transfected cell lines compared with wild type and vector controls. Overexpression of CuZnSOD altered cellular antioxidant enzyme profiles, including those of manganese superoxide dismutase, catalase, and GPx. The transfected clone with the highest CuZnSOD:GPx ratio (3.5) showed a 42% inhibition of tumor cell growth in vitro. The decreased rate of tumor cell growth in vitro was strongly correlated with the enzyme activity ratio of CuZnSOD:GPx. Glioma cells that stably overexpressed CuZnSOD demonstrated additional suppressive effects on the malignant phenotype when compared with the parental cells and vector controls. These cells showed decreased plating efficiency, elongated cell population doubling time, lower clonogenic fraction in soft agar, and, more significantly, inhibition of tumor formation in nude mice. This work suggested that CuZnSOD is a new tumor suppressor gene. Increased intracellular ROS levels were found in cells with high activity ratios of CuZnSOD:GPx. Change in the cellular redox status, especially change attributable to the accumulation of hydrogen peroxide or other hydroperoxides, is a possible reason to explain the suppression of tumor growth observed in CuZnSOD-overexpressing cells.
Animals↗
v-Ha-ras mitogenic signaling through superoxide and derived reactive oxygen species.
The ras proto-oncogene is frequently mutated in human tumors and functions to constitutively stimulate signal transduction cascades, resulting in unchecked proliferation and malignant transformation. In certain cells, superoxide functions as a signal-transduction messenger, mediating the downstream effects of ras and rac. We demonstrated previously that v-Ha-ras-transfected rat kidney epithelial cells (RECs) overproduced superoxide anion and that this superoxide production was mediated by ras. In the present study, we further demonstrated that v-Ha-ras overexpression transformed immortal nonmalignant RECs into malignant cancer cells; v-Ha-ras-transfected cells formed clones in soft agar, had high plating efficiency, and formed tumors in nude mice. Our data suggest that superoxide radical plays a role in ras-induced transformation; modulation of intracellular superoxide level by overexpression of manganese-containing superoxide dismutase or copper- and zinc-containing superoxide dismutase inhibited ras-induced transformation, as evidenced by in vitro studies of plating efficiency and by in vivo studies of tumor formation in nude mice. Overexpression of catalase (CAT) alone was found to have little effect on tumor cell growth, but overexpression of glutathione peroxidase 1 (GPx1) completely suppressed tumor cell growth in nude mice. This finding suggests that peroxides removed by GPx1, but not by CAT, are also involved in ras-induced transformation.
Animals↗
Acetaldehyde activates Jun/AP-1 expression and DNA binding activity in human oral keratinocytes.
Oral cancer is a significant health problem, particularly among individuals that ingest alcohol in combination with the use of tobacco products. The enhanced development of tobacco-initiated oral cancers by ethanol suggests that ethanol or one of its metabolites may act as a type of tumor promoter. Nevertheless, the mechanisms underlying the ability of ethanol to enhance oral carcinogenesis remain unclear. We hypothesize that acetaldehyde, the first metabolite of ethanol, may activate the expression and/or activity of Jun/AP-1 in oral keratinocytes analogous to the phorbol ester TPA and other tumor promoters in epidermal keratinocytes. To test this hypothesis, we treated HPV immortalized, non-tumorigenic human oral keratinocytes with acetaldehyde at various concentrations and for various times and measured several parameters of Jun/AP-1expression and function. Our results indicated that c-Jun mRNA and protein levels increased in the acetaldehyde treated cells compared to untreated control cells. Moreover, Jun/AP-1 DNA binding activity was rapidly activated by acetaldehyde in a dose-dependent fashion. The increases in Jun protein and AP-1 DNA binding activity were accompanied by increased transactivation of an AP-1 responsive reporter construct as well as increased transcript levels of a candidate AP-1 responsive gene, stromelysin 3. The levels of acetaldehyde employed were minimally toxic to the cells as determined by MTT assays. Thus, acetaldehyde was found to activate the expression and activity of an oncogenic transcription factor in HPV-initiated cells. Taken together, these results suggest that acetaldehyde may participate, at least in part, in the promotion stage of oral carcinogenesis.
Acetaldehyde↗
Dominant negative interference of transcription factor AP-2 causes inhibition of ErbB-3 expression and suppresses malignant cell growth.
ErbB-3 (HER3) is a member of the epidermal growth factor receptor family. Increasing evidence suggests that elevated expression of ErbB-3 is important for malignancy. In this study, we found that elevated levels of ErbB-3 expression did not occur in the absence of AP-2gamma in a panel of human mammary epithelial and fibroblasts cell lines. In contrast, there was no association between the expression of AP-2alpha or AP-2beta and the level of ErbB-3, or between AP-2alpha and AP-2gamma double positivity and ErbB-3 expression. In co-transfection experiments, exogenous expression of AP-2gamma robustly activated ErbB-3 promoter activity. Moreover, expression of a dominant negative AP-2 protein, AP-2delta (deleted residues 31-117), not only repressed the ErbB-3 promoter activity but also suppressed endogenous ErbB-3 transcription in the ErbB-3 overexpressing cell line MRC-5VA. Overexpression of AP-2A resulted in a decreased proliferation rate and inhibitin of colony formation. Taken together, these data strongly support a role for the AP-2 gene family, in particular, AP-2gamma, in the control of ErbB-3 expression. Interference with the function of transcription factor AP-2 might provide a potential strategy for modulation of the malignant phenotype.
Breast↗
Redox regulation of adenovirus-induced AP-1 activation by overexpression of manganese-containing superoxide dismutase.
Adenovirus gene therapy is a promising tool in the clinical treatment of many genetic and acquired diseases. However, it has also caused pathogenic effects in organs such as the liver. The redox-sensitive transcription factors AP-1 and NF-kappaB have been implicated in these effects. To study the mechanisms of adenovirus-mediated AP-1 and NF-kappaB activation and the possible involvement of oxidative stress in adenovirus transduction, rats were injected with either replication-defective recombinant adenovirus with DNA containing the cytomegalovirus promoter region only (AdCMV), adenovirus containing human manganese-containing superoxide dismutase (MnSOD) cDNA (AdMnSOD), or vehicle. Compared to vehicle and AdCMV transduction, MnSOD gene transfer yielded a fivefold increase in liver MnSOD activity 7 days postinjection. Gel shift assay showed that AdCMV transduction induced DNA binding activity for AP-1 but not NF-kappaB. MnSOD overexpression abolished this activation. Western blotting analysis of c-Fos and c-Jun suggested that up-regulation of c-fos and c-jun gene expression does not directly contribute to the induction of AP-1 activation. Glutathione/glutathione disulfide ratios were decreased by adenovirus transduction and restored by MnSOD overexpression. The AP-1 binding activity that was induced by AdCMV was decreased by immunoprecipitation of Ref-1 protein. Ref-1 involvement was confirmed by restoration of AP-1 binding activity after the immunoprecipitated Ref-1 protein had been added back. AP-1 DNA binding activity was also elevated in control and AdMnSOD-injected rats after addition of the immunoprecipitated Ref-1 protein. These data indicate that cellular transduction by recombinant adenovirus stimulates AP-1 DNA binding activity. Furthermore, our results suggest that MnSOD overexpression decreases AP-1 DNA binding activity by regulating intracellular redox status, with the possible involvement of Ref-1 in this redox-sensitive pathway.
Adenoviridae↗
Identification of a functional peroxisome proliferator-activated receptor response element in the rat catalase promoter.
Peroxisomal proliferator-activated receptor (PPAR)gamma has been shown to decrease the inflammatory response via transrepression of proinflammatory transcription factors. However, the identity of PPARgamma responsive genes that decrease the inflammatory response has remained elusive. Because generation of the reactive oxygen species hydrogen peroxide (H(2)O(2)) plays a role in the inflammatory process and activation of proinflammatory transcription factors, we wanted to determine whether the antioxidant enzyme catalase might be a PPARgamma target gene. We identified a putative PPAR response element (PPRE) containing the canonical direct repeat 1 motif, AGGTGA-A-AGTTGA, in the rat catalase promoter. In vitro translated PPARgamma and retinoic X receptor-alpha proteins were able to bind to the catalase PPRE. Promoter deletion analysis revealed that the PPRE was functional, and a heterologous promoter construct containing a multimerized catalase PPRE demonstrated that the PPRE was necessary and sufficient for PPARgamma-mediated activation. Treatment of microvascular endothelial cells with PPARgamma ligands led to increases in catalase mRNA and activity. These results demonstrate that PPARgamma can alter catalase expression; this occurs via a PPRE in the rat catalase promoter. Thus, in addition to transrepression of proinflammatory transcription factors, PPARgamma may also be modulating catalase expression, and hence down-regulating the inflammatory response via scavenging of reactive oxygen species.
Animals↗