Search PubMed⌕ Search

Biomedical subjects

F Takaiwa

Publications and source records attributed to F Takaiwa.

50 records · Page 3Linked to original sources
PubMed1986

The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression.

The complete nucleotide sequence (155 844 bp) of tobacco (Nicotiana tabacum var. Bright Yellow 4) chloroplast DNA has been determined. It contains two copies of an identical 25 339 bp inverted repeat, which are separated by a 86 684 bp and a 18 482 bp single-copy region. The genes for 4 different rRNAs, 30 different tRNAs, 39 different proteins and 11 other predicted protein coding genes have been located. Among them, 15 genes contain introns. Blot hybridization revealed that all rRNA and tRNA genes and 27 protein genes so far analysed are transcribed in the chloroplast and that primary transcripts of the split genes hitherto examined are spliced. Five sequences coding for proteins homologous to components of the respiratory-chain NADH dehydrogenase from human mitochondria have been found. The 30 tRNAs predicted from their genes are sufficient to read all codons if the ;two out of three' and ;U:N wobble' mechanisms operate in the chloroplast. Two sequences which autonomously replicate in yeast have also been mapped. The sequence and expression analyses indicate both prokaryotic and eukaryotic features of the chloroplast genes.

Journal Article↗
PubMed1985

Location and nucleotide sequence of the genes for tobacco chloroplast tRNAArg (ACG) and tRNALeu(UAG).

The location and nucleotide sequence of the genes and flanking regions for tRNAArg(ACG) and tRNALeu(UAG) on tobacco chloroplast DNA have been determined. The gene arrangement is 5S rRNA-260 bp-tRNAArg-581 bp-tRNAAsn-5.2 kbp-tRNALeu. The tRNAArg and tRNALeu genes are expressed in the chloroplasts. The opposite strand of the tRNAArg gene contains a tRNAArg-like sequence. The tRNAArg, tRNAAsn and tRNALeu coding regions are contained in open reading frames.

Base Sequence↗
PubMed1985

Phylogenetic relationships among eukaryotic kingdoms inferred from ribosomal RNA sequences.

Phylogenetic trees among eukaryotic kingdoms were inferred for large- and small-subunit rRNAs by using a maximum-likelihood method developed by Felsenstein. Although Felsenstein's method assumes equal evolutionary rates for transitions and transversions, this is apparently not the case for these data. Therefore, only transversion-type substitutions were taken into account. The molecules used were large-subunit rRNAs from Xenopus laevis (Animalia), rice (Plantae), Saccharomyces cerevisiae (Fungi), Dictyostelium discoideum (Protista), and Physarum polycephalum (Protista); and small-subunit rRNAs from maize (Plantae), S. cerevisiae, X. laevis, rat (Animalia), and D. discoideum. Only conservative regions of the nucleotide sequences were considered for this study. In the maximum-likelihood trees for both large- and small-subunit rRNAs, Animalia and Fungi were the most closely related eukaryotic kingdoms, and Plantae is the next most closely related kingdom, although other branching orders among Plantae, Animalia, and Fungi were not excluded by this work. These three eukaryotic kingdoms apparently shared a common ancestor after the divergence of the two species of Protista, D. discoideum and P. polycephalum. These two species of Protista do not form a clade, and P. polycephalum diverged first and D. discoideum second from the line leading to the common ancestor of Plantae, Animalia, and Fungi. The sequence data indicate that a drastic change occurred in the nucleotide sequences of rRNAs during the evolutionary separation between prokaryote and eukaryote.

Animals↗
PubMed1985

The complete nucleotide sequence of a rice 25S.rRNA gene.

The complete nucleotide (nt) sequence of a rice nuclear 25S.rRNA gene has been determined. The 25S.rRNA-coding region is 3377 bp long. The G + C content is 59.4%. The structural organization of this rRNA is very similar to that of yeast 26S rRNA.

Base Sequence↗
PubMed1984

The complete nucleotide sequence of a rice 17S rRNA gene.

The complete nucleotide sequence of a rice nuclear 17S rRNA gene (rDNA) has been determined. The rice rDNA is 1812 bp long and its G + C content is 51.3%. This nucleotide sequence shows 79%, 80% and 80% homology to those of yeast, Xenopus laevis and rat 18S rDNAs, respectively. Divergency of nucleotide sequences is largely attributed to five blocks of highly variable regions, where eukaryotic specific sequences can be observed.

Animals↗
PubMed1982

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Base Sequence↗
PubMed1982

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.

Base Sequence↗
PubMed1982

Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences.

Base Composition↗
PubMed1982

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

Base Sequence↗
PubMed1982

The complete nucleotide sequence of a 23-S rRNA gene from tobacco chloroplasts.

The nucleotide sequence of a tobacco chloroplast 23-S rRNA gene, including the spacer between it and the 4.5-S rRNA gene, has been determined. The 23-S rRNA coding region is 2804-base-pairs long. A comparison with the 23-S rRNA sequence of Escherichia coli reveals strong homology and further shows a similarity between the chloroplast 4.5-S rRNA and the 3'-terminal region of E. coli 23-S rRNA. However, the 101-base-pair spacer sequence between the 23-S and 4.5-S rRNA genes has little homology with E. coli 23-S rRNA.

Base Sequence↗
PubMed1980

The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

Base Sequence↗
PubMed1980

Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts.

Tobacco chloroplast 4.5S and 5S RNAs were shown to hybridize with a 0.9 . 10(6) dalton EcoRI fragment of tobacco chloroplast DNA. Recombinant plasmids were constructed from fragments produced by partial digestion of the chloroplast DNA with EcoRI and the pMB9 plasmid as a vector. Five recombinants containing the 4.5S and 5S genes were selected by the colony hybridization technique. One of these plasmids contained also the 16S and 23S RNA genes and was mapped using several restriction endonucleases as well as DNA-RNA hybridization. The order of rRNA genes is 16S-23S-4.5S-5S and the four rRNA genes are coded for by the same DNA strand.

Chloroplasts↗
PubMed1976

Double strandedness of nascent DNA of a higher plant (Vicia faba).

After a pulse of 5-10 min with [3H]thymidine, labeled DNA extracted from embryonic axes of Vicia seeds sedimented as a rather homogeneous peak at approx. 10S in an alkaline sucrose density gradient, as described in our previous paper ((1975) Biochim. Biophys. Acta 395, 314-321). The sedimentation pattern of the same pulse-labeled DNA in a neutral gradient showed a wide range of sizes from approx. 14 S to more than 40 S. However, most of these labeled DNA components, including the 14-20 S shorter fragments, were shown to have a double-stranded structure by hydroxyapatite column chromatography. Further investigations on neutral sucrose gradients revealed a decreased occurrence after a chase, and final disappearance after a longer chase period of these shorter double-stranded fragments. A possible secondary structure of the newly synthesized DNA in a higher plant (Vicia faba) is discussed.

Centrifugation, Density Gradient↗