Biomedical subjects

F Quadrifoglio

Publications and source records attributed to F Quadrifoglio.

At least 37 records · Page 2Linked to original sources

PubMed1994

Effect of unmodified triple helix-forming oligodeoxyribonucleotide targeted to human multidrug-resistance gene mdr1 in MDR cancer cells.

The human mdr1 gene encodes a transmembrane glycoprotein the over-expression of which is associated with development of multidrug resistance in human tumor cells. A negative modulation of human mdr1 has been attempted via a 27-mer unmodified triple helix-forming oligonucleotide, named 1D, targeted to a homopurine sequence in the coding region of the gene. By administering 10 microM of 1D we could find a significant reduction in MDR1 mRNA levels in the human drug-resistant cell line CEM-VLB100. This effect appears to be specific and due to a transient block of RNA polymerase mediated by triple helix formation.

ATP Binding Cassette Transporter, Subfamily B, Mem↗

PubMed1994

Pyrimidine phosphorothioate oligonucleotides form triple-stranded helices and promote transcription inhibition.

The ability of phosphorothioate (POS) oligonucleotides to recognise and bind to homopurine-homopyrimidine DNA double-stranded sites via triple helix formation has been investigated. It has been found that the homologous pyrimidine POS sequences Y11-Si (i = 0, 1,2,3,4,10), which have been obtained by an increasing sulphur substitution in the sugar-phosphate backbone of d(CTTCCTCCTCT) (Y11), and the target hairpin duplex d(GAAGGAGGAGA-T4-TCTCCTCCTTC) (h26) can form stable triple helices, as indicated by PAGE, CD and UV melting experiments. The thermal stability of the triple helices depends on the number of POS linkages in the third Y11 strand, varying from 48 degrees C (Y11, with only phosphate groups, PO2) to 31 degrees C (Y11-S10 containing exclusively thioate groups). On average, a Tm depression of about 2 degrees C per POS linkage introduced in Y11 was observed. CD data indicate that the sulphurization of the third strand results in minimal changes of triple-stranded structures. The energetics of the triplex-to-hairpin plus single-strand transition has been determined by van't Hoff analyses of the melting curves. In free energy terms, the POS triplexes h26.Y11-Si are less stable than the normal PO2 h26.Y11 triplex by values between 2.7 and 5.4 kcal/mol, depending on the number of POS linkages contained in the third strand. Phosphorothioate oligonucleotides being resistant towards several nucleases offer an interesting choice as gene blockers in antisense strategy. Thus, their ability to inhibit transcription via triple helix formation has been examined in vitro. We found that triplex-forming POS oligonucleotides of 20 bases in length (with a cytosine contents of 45%), containing either 10% or 26% thioate groups, strongly repress the transcription activity of the bacteriophage T7 RNA polymerase at pH 6.9, when used in excess compared to the target (mol oligo/mol template = 125). The here reported data are useful for designing phosphorothioate oligonucleotides targeted to genomic DNA in antigene strategy.

Base Sequence↗

PubMed1994

Sequence-specific DNA recognition by the thyroid transcription factor-1 homeodomain.

The molecular basis for the DNA binding specificity of the thyroid transcription factor 1 homeodomain (TTF-1HD) has been investigated. Methylation and ethylation interference experiments show that the TTF-1HD alone recapitulates the DNA binding properties of the entire protein. Studies carried out with mutant derivatives of TTF-1HD indicate a precise correspondence of some of its amino acid residues with specific bases in its binding site, allowing a crude orientation of the TTF-1HD within the protein-DNA complex. TTF-1HD shows an overall geometry of interaction with DNA similar to that previously observed for Antennapedia class HDs, even though the binding specificities of these two types of HDs are distinct. We demonstrate that the crucial difference between the binding sites of Antennapedia class and TTF-1 HDs is in the motifs 5'-TAAT-3', recognized by Antennapedia, and 5'-CAAG-3', preferentially bound by TTF-1. Furthermore, the binding of wild type and mutants TTF-1 HD to oligonucleotides containing either 5'-TAAT-3' or 5'-CAAG-3' indicate that only in the presence of the latter motif the Gln50 in TTF-1 HD is utilized for DNA recognition. Since the Gln at position 50 is an essential determinant for DNA binding specificity for several other HDs that bind to 5'-TAAT-3' containing sequences, we suggest that utilization by different HDs of key residues may depend on the sequence context and probably follows a precise hierarchy of contacts.

Antennapedia Homeodomain Protein↗

PubMed1993

Ionic factors regulating the interaction of Gardnerella vaginalis hemolysin with red blood cells.

We have studied the hemolytic properties of an exotoxin released by Gardnerella vaginalis (Gvh). We found that hemolysis induced by Gvh is modulated by the composition of the isotonic buffer in which the red cells are suspended. In particular, low pH enhances its lytic activity, whereas low ionic strength and divalent cations diminish it. The inhibitory effects of reduced salt concentration and divalent cations occur despite normal binding of the toxin to the cells. This suggests that some post-binding step is impaired. The toxin is also able to damage cholesterol-containing lipid vesicles, and even on these model membranes it is more active at low pH. From this point of view, Gvh has some similarity to Clostridium perfringens theta-toxin, a membrane-damaging toxin belonging to the family of 'thiol-activated' cytolysins produced by Gram-positive bacteria.

Bacterial Toxins↗

PubMed1993

Sequence-specific DNA-triplex formation at imperfect homopurine-homopyrimidine sequences within a DNA plasmid.

The ability of pyrimidine-rich and purine-rich oligodeoxynucleotides to form stable triple-helical structures with imperfect R.Y target sites, containing C interruptions in the purine strand (CG inversions) and located within Bluescript KS+, a plasmid of 2959 bp, has been investigated by electrophoresis, ultraviolet absorbance and cleavage-protection experiments. First, we synthesized double-stranded oligonucleotides corresponding to the plasmid sites and studied their interaction with oligopyrimidines which oppose either G or T to CG inversions. The resulting imperfect DNA triplexes were detected by gel-mobility shift. Their melting profiles were found to be biphasic, and the triplex-to-duplex plus single-strand transition was affected by hysteresis. The 21-nucleotide triplex containing three GC.G mismatched triads had tm = 45 degrees C, while the same triplex, but with three GC.T triads, had tm = 31 degrees C. Moreover, replacing C with 5-methylcytosine in the third strand resulted in a significant stabilization of the defective triplex, tm = 49 degrees C. The potential of the 21-nucleotide oligopyrimidines to recognize and bind in a sequence-specific manner to imperfect R.Y sequences in Bluescript KS+ has been investigated by means of a restriction-endonuclease-protection assay, taking advantage of the fact that one R.Y sequence of Bluescript KS+ was partially overlapped with a HaeII site. Effective endonuclease inhibition was observed with oligopyrimidines opposing G-to-GC inversions, at 10-50 microM. By contrast, the oligopyrimidine opposing T-to-CG inversions did not exhibit any interference with endonuclease activity in our standard conditions. Finally, we have tested the ability of purine-rich strands to bind the R.Y sites of Bluescript KS+. A very weak cleavage protection was observed by using an oligomer (130 microM) with a polarity antiparallel to the purine strand of the target site. The resulting Y.R.R triplex was stabilized by CG.G (GC.G) and TA.A base triplets. This triplex denatures with a low cooperative melting profile suggesting the absence of strong interactions between the third strand and the target site.

Base Sequence↗

PubMed1993

Pore-forming and haemolytic properties of the Gardnerella vaginalis cytolysin.

The pleomorphic bacterium Gardnerella vaginalis releases in the culture broth a haemolytic exotoxin (Gvh) which is probably a virulence determinant of this unique bacterium, implicated in gynaecological and urological disorders. This 59 kDa cytolysin was purified to homogeneity in just one chromatographic step directly from the culture supernatant, a final specific activity up to 1.9 x 10(6) HU mg-1 being obtained. The toxin-induced lesion on human erythrocytes results from the formation of a pore whose radius is approximately 2.4 nm. The damage is inhibited by osmotic protectants and shows a sigmoidal dose-response profile suggesting an aggregation process of haemolysin molecules on the target membrane to create the functional lesion. The extent and the kinetics of haemolysis are strongly dependent on temperature and an activation energy of 64.0 kJ mol-1 has been derived. Lipid membranes can be very efficient inhibitors of Gvh-haemolysis, being able to bind the toxin quite avidly. The inhibitory effect requires the presence of cholesterol and it is stronger when cholesterol is mixed with negatively charged phospholipids rather than with zwitterionic phospholipids, suggesting that a negative surface potential increases the affinity of the toxin for the lipid bilayer. The functional properties of Gvh have been compared with those of Clostridium perfringens thetatoxin (PFO) and Escherichia coli haemolysin (HlyA), which are representative of widespread haemolysins produced by Gram-positive and Gram-negative bacteria, respectively. The toxin shares several features with the family of the so-called 'sulphydryl-activated' cytolysins produced by Gram-positive bacteria, although Gvh does not truly belong to this family, being deactivated by beta-mercaptoethanol and being antigenically distinct from them. We report here for the first time the detection in the vaginal fluid of infected women of a specific IgA response against the toxin.

Cholesterol↗

PubMed1992

NMR structural characterization of the reaction product between d(GpG) and the octahedral antitumor complex trans-RuCl2(DMSO)4.

The reaction between the antitumor octahedral complex trans-RuCl2(DMSO)4 and d(GpG) leads to the formation of a stable compound characterized by a covalent bifunctional coordination of the bases to the metal center. The structure of the compound has been fully characterized by NMR and molecular modeling studies, showing the presence of two N7-coordinated guanine moieties in a head to head conformation, two dimethyl sulfoxide molecules, and one halogen atom in the coordination sphere of the ruthenium. The glycosidic chi angles are essentially in the anti range, the sugar puckering of the 5'G is 3'-endo (100% N), whereas that of the 3'G is more flexible but mainly in 2'-endo conformation (85% S), the two bases are strongly destacked. The compound shows structural features which are surprisingly similar to those exhibited by the corresponding cisplatin complex, indicating that such a way of interaction with DNA is not exclusive to Pt or to metals with square planar coordination geometries.

Antineoplastic Agents↗

PubMed1992

Charge effect in the interaction of doxorubicin and derivatives with polydeoxynucleotides.

The equilibrium interaction of doxorubicin and its N-acetyl derivative with a series of purine-pyrimidine alternating polydeoxynucleotides has been studied through spectrofluorometry to assess the relevance of the electrostatic contribution to DNA intercalation. The results have shown that: (a) the suppression of the positive charge on the aminosugar has: (I) a profound negative effect on the free energy of intercalation, as expected, and (II) a negligible influence on the base specificity, which supports the notion of an essentially electrostatic effect of N-acetylation on intercalation; (b) a reasonably good accord with the demands of a polyelectrolytic model, due to Friedman and Manning, is found.

DNA↗

PubMed1991

Effect of 5-methylcytosine on the stability of triple-stranded DNA--a thermodynamic study.

We have previously shown that the pyrimidine oligonucleotide 5'CTTCCTCCTCT (Y11) recognizes the double-helical stem of hairpin 5'GAAGGAGGAGA-T4-TCTCCTCCTTC (h26) by triple-helix formation (1). In this paper, we report the effect on triplex formation of substituting the cytosine residues of Y11 with 5-methylcytosines (5meY11). In addition, we have studied the thermodynamics of the interaction between h26 and 5meY11. The results can be summarised as follows: (i) gel electrophoresis shows that at T = 5 degrees C and pH 5, both Y11 and 5meY11 form DNA triple helices with h26, whereas at pH 6.8 only the methylated strand binds to h26; (ii) pH-stability curves of the DNA triplexes formed from h26 + Y11 and h26 + 5meY11 show that Y11 and 5meY11 are semi-protonated at pH 5.7 and 6.7, respectively. Thus, it is concluded that cytosine methylation expands the pH range compatible with triplex formation by one pH unit; (iii) as the unmethylated triplex (h26:Y11), the methylated one (h26:5meY11) denatures in a biphasic manner, in which the low temperature transition results from the dissociation of 5meY11 from h26. The Tm of the triplex to h26 plus 5meY11 transition is strongly enhanced (about 10 degrees C) by cytosine methylation. A van 't Hoff analysis of denaturation curves is presented; (iv) DSC experiments show that triplex formation between 5meY11 and h26 is characterized by delta H = -237 +/- 25 kJ/mol and delta S = -758 +/- 75 J/Kmol, corresponding to an average delta H of -21 kJ/mol and delta S of -69 J/Kmol per Hoogsteen base pair; (v) the thermodynamic analysis indicates that the extra stability imparted to the triplex by methylcytosine is entropic in origin.

5-Methylcytosine↗

PubMed1991

DNA hairpin loops in solution. Correlation between primary structure, thermostability and reactivity with single-strand-specific nuclease from mung bean.

Hairpin structures formed by seven DNA inverted repeats have been studied by PAGE, UV(CD)-spectroscopy and nuclease cleavage. The hairpins consisted of (CG)3 stems and loops of 2, 3 and 4 residues. Thermal stabilities (Tm) have been determined in low and high ionic strength buffers, where the hairpins were structured in the B- and Z-DNA form respectively. The thermodynamic parameters of hairpin formation have been obtained by a two-state analysis of the hairpin-coil transitions. It is found that, on increasing the number of bases in the loop from 2 to 3 and 4, the Tms of the B-hairpins decrease, whereas the Tms of the same hairpins in the Z-form increase. This confirms previous evidence (1,2) that in a hairpin molecule the size and structure of the loop are modulated by the conformation of the helical stem. Moreover, B-hairpins with loops comprising 2, 3 and 4 bases have been digested with the single-strand-specific nuclease from mung bean. In our experimental conditions (0 degrees C) the nuclease preferentially cleaves the unbonded nucleotides of the loops. However, the rates of loop hydrolysis, which roughly follow a first-order kinetics, markedly depend on the size of the loop. At a ratio of 3 enzyme units/micrograms DNA, the half-lives of hairpins which are expected to form loops of 4, 3 and 2 residues are 90, 145 and 440 minutes respectively. Thermostability and enzymatic digestion data suggest that two-membered loops can be formed in B-hairpins but not in Z-hairpins.

Base Sequence↗

PubMed1991

Reaction of the octahedral antitumor complex trans-RuCl2 (DMSO)4 with 2'deoxyguanosine.

The reaction of the antitumor octahedral complex trans-RuCl2(DMSO)4 with 2'deoxyguanosine leads to the reversible formation of two diastereoisomeric monoadducts and one biadduct. This shows that it is possible to accommodate two purine bases in a cis configuration in an octahedral transition metal complex which exhibits antiblastic activity. All the product compounds are characterized by a guanine moiety coordination via the N7 atom. A marked decrease (about two pK units) is observed for the N1H pKa of the coordinated guanine moieties. The reversibility of the monodentate binding could explain the low toxicity of the ruthenium(II) complexes.

Antineoplastic Agents↗

PubMed1990

Spectroscopic and calorimetric investigation on the DNA triplex formed by d(CTCTTCTTTCTTTTCTTTCTTCTC) and d(GAGAAGAAAGA) at acidic pH.

The equimolar mixture of d(CTCTTCTTTCTTTTCTTTCTTCTC) (dY24) and d(GAGAAGAAAGA) (dR11) [designated (dY24).(dR11)], forms at pH = 5 a DNA triplex, which mimicks the H-DNA structure. The DNA triplex was identified by the following criteria: (i) dY24 and dR11 co-migrate in a poly-acrylamide gel, with a mobility and a retardation coefficient comparable to those observed for an 11-triad DNA triplex, previously characterized in our laboratories (1); (ii) the intercalator ethidium bromide shows a poor affinity for (dR11).(dY24) at pH = 5, and a high affinity at pH = 8; (iii) the (dR11).(dY24) mixture is not a substrate for DNase I at pH = 5; (iv) the CD spectrum of (dR11).(dY24), at pH = 5, is consistent with those previously reported for triple-stranded DNA. The (dR11).(dY24) mixture exhibits a thermally induced co-operative transition, which appears to be monophasic, reversible and concentration dependent. This transition is attributed to the disruption of the DNA triplex into single strands. The enthalpy change of the triplex-coil transition was measured by DSC (delta Hcal = 129 +/- 6 kcal/mol) and, assuming a two-state model, by analysis of UV-denaturation curves (average of two methods delta HUV = 137 +/- 13 kcal/mol). Subtracting from delta Hcal of triplex formation the contributions due to the Watson-Crick helix and to the protonation of the C-residues, we found that each pyrimidine binding into the major groove of the duplex, through a Hoogsteen base pair, is accompanied by an average delta H = -5.8 +/- 0.6 kcal/mol. The effect on the stability of the (dR11).(dY24) triplex due to the substitution of a T:A:T triad with a T:T:T one was also investigated.

Base Sequence↗

PubMed1990

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior.

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Base Sequence↗

PubMed1989

A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.

Animals↗

PubMed1989

Hairpin structures in synthetic oligodeoxynucleotides: sequence effects on the duplex-to-hairpin transition.

We have synthesized and examined a number of fully and partly self-complementary palindromic oligodeoxynucleotides for their ability to assume in solution a unimolecular hairpin structure. The main results obtained by a combined optical and electrophoresis investigation show that: (i) DNA folding needs not be driven by mismatched base pairings over the dyad; fully self-complementary palindromic duplexes, comprising regular (CG)n DNA fragments, possess a considerable intrinsic propensity to make intramolecular base pairings; (ii) The duplex-hairpin interconversion is, in general, a slow process independent of the length and base composition of the palindrome; (iii) The palindromic sequences energetically least favored to form hairpin structures consist of C:G base pairs around the dyad axis and of T:A blocks in the arms of the inverted repeat; (IV) The base composition of the stem strongly influences the hairpin thermal stability. For instance, the substitution of one C:G with one A:T base pair in the stem helix of d(CG)7 diminishes the stability of the hairpin by 9 degrees C. It is found that the stability of the stem helix, in hairpins of defined sequence and with the same loop length, decreases in the order alternating-CG greater than homo-CG greater than AC(GT) greater than alternating-AT, i.e. as in polynucleotides. The thermodynamic parameters for the hairpin-coil transition are reported.

Base Composition↗

PubMed1989

The left-handed Z-DNA conformation in oligodeoxynucleotides containing different amounts of AT base pairs: a far UV circular dichroism study.

A number of fully self-complementary oligodeoxynucleotides have been synthesized and examined for their ability to assume the left-handed Z-DNA conformation in high salt solutions. The B- and Z-forms are identified by circular dichroism spectra, covering both the long- (220-300 nm) and short-wavelength (185-220 nm) regions, the latter showing CD bands very useful for identifying the sense of the helix winding. The main results of the study can be summarized as follows: a) sequences composed by AT and CG blocks do support the B to Z transition, even when the AT contents amounts to 50%; b) the occurrence of consecutive purine-purine or pyrimidine-pyrimidine dyads does not inhibit the B to Z transition, although a stronger reduction of water activity is required; c) (AC)n and (GT)n containing oligonucleotides do undergo the B to Z transition in solution; d) a millimolar quantity of Ni2+ concomitant with 5 M NaClO4 is found to be very effective in bringing about the B to Z transition in most of the sequences considered in this study.

Adenine↗

PubMed1988

Oligodeoxynucleotide folding in solution: loop size and stability of B-hairpins.

The secondary structures of the synthetic DNA fragments d(CGCGCGTTTTTCGCGCG) (T5), d(CGCGCGAAAAACGCGCG) (A5), d(CGCGCGTACGCGCG) (TA), and d(CGCGCGATCGCGCG) (AT) were investigated in a combined electrophoretic and spectroscopic study. All the oligomers exist, at low temperature and over a wide range of ionic strength (0.5-100 mM salt) and of nucleotide concentration [0.1-2.0 mM (phosphate)], as a mixture of two slowly interconverting species, identified as the dimeric duplex and the monomeric hairpin structure. The thermodynamic parameters for hairpin denaturation of T5, A5, TA, and AT and for duplex denaturation of d(CGCGCG) show that (a) the hairpins are more stable than the reference hexamer duplex at all accessible nucleotide concentrations; (b) the loop contributes favorably to the enthalpy change of hairpin denaturation in the four DNA fragments; (c) the base composition of the loop (A vs T) and the size of the loop (A5/T5 vs TA/AT) do not appreciably influence the enthalpic contents of the hairpins; (d) hairpins TA and AT, with two AT bases intervening in the CG self-complementary part of the molecule, exhibit a markedly higher thermal stability than hairpins T5 and A5, which is entropic in origin. These findings are consistent with the presence of two-residue loops in the tetradecamers TA and AT.

Base Composition↗

PubMed1988

The B-Z conformational transition in folded oligodeoxynucleotides: loop size and stability of Z-hairpins.

The capacity to assume a left-handed conformation and the thermodynamics of loop formation in concentrated aqueous NaClO4 have been investigated for the following palindromic sequences: d-(CGCGCGAAAAACGCGCG) (A5), d(CGCGCGTTTTTCGCGCG) (T5), d(CGCGCGTACGCGCG) (TA), and d(CGCGCGATCGCGCG) (AT). The results show that (a) each oligomer assumes a Z conformation upon exposure to increasing NaClO4 concentrations; the salt concentration at the transition midpoint is 1.8 M for both A5 and T5 and 3 and 3.5 M for TA and AT, respectively; (b) in high salt the four oligomers exist, over a wide range of nucleotide concentrations (up to 10(-3) M) and of temperature (greater than 0 degrees C), as unimolecular hairpin structures; (c) hairpins TA and AT exhibit, in buffer A, a lower thermal stability with respect to A5 and T5 (delta T about 16 degrees C), contrary to what is observed at low ionic strength; (d) on hairpin formation, the enthalpic term is about -52 kcal/mol for the two 17-mers and -38 kcal/mol for the two 14-mers, while the change in entropy is found to be around -150 eu for A5 and T5 and -115 eu for TA and AT. This thermodynamic picture suggests that a two-residue loop for TA and AT, found at low ionic strength [see preceding paper (Xodo, L.E., Manzini, G., Quadrifoglio, F., van der Marel, G.A., & van Boom, J.H. (1988) Biochemistry (preceding paper in this issue)], is substituted by a longer one including two additional residues from a missing dC.dG base pairing at the top of the stem.

Base Sequence↗